Rh3BG323000

Gpi-anchor

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Reverse (-)
33326833 .. 33344888
18056 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG323000.1

Sequence Viewer

Length: 318 bp
ATGCACACCAACAATTGGACTGTTCTGGCCTGCACCTCTCGCTTCTGGACGGTTAAGCGACTTGGAATACCTGATGAGAGGATAATACTTATGCTGGCAGGTGACATGGCCTGTAATGCTAGAAACAAGTACCCTGCCCAAGTTTTTAATGATGAAAATCAGAGACTCAACTTGTATGGAGATAATGATGAGGGTCTACTTAGCATTCATCATCGAAAGACGGAGAAAAAGCCTATTAAGTATAAGAGTGAACATCATTTTTTCCCAATACCCAAGCTAACAAGGCAGTTGCGACGTGATTTGGAATGCAACATGTAG

Protein Analysis

105

Amino Acids

12.45

Weight (kDa)

9.33

Isoelectric Point (pI)

46.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 89
Acc36I ACCTGC 1 cut(s) 89
AccB7I CCANNNNNTGG 1 cut(s) 15
AccI GTMKAC 1 cut(s) 196
AfaI GTAC 1 cut(s) 131
AfiI CCNNNNNNNGG 1 cut(s) 15
AflIII ACRYGT 1 cut(s) 312
AjiI CACGTC 1 cut(s) 296
AluBI AGCT 1 cut(s) 277
AluI AGCT 1 cut(s) 277
Alw26I GTCTC 1 cut(s) 157
AoxI GGCC 2 cut(s) 27, 108
AsuHPI GGTGA 1 cut(s) 113
BcoDI GTCTC 1 cut(s) 157
BfaI CTAG 1 cut(s) 120
BfuAI ACCTGC 1 cut(s) 89
BmgBI CACGTC 1 cut(s) 296
BsaBI GATNNNNATC 1 cut(s) 156
Bsc4I CCNNNNNNNGG 1 cut(s) 15
Bse8I GATNNNNATC 1 cut(s) 156
BseJI GATNNNNATC 1 cut(s) 156
BseLI CCNNNNNNNGG 1 cut(s) 15
BsgI GTGCAG 1 cut(s) 16
BshFI GGCC 2 cut(s) 29, 110
BslI CCNNNNNNNGG 1 cut(s) 15
BsmAI GTCTC 1 cut(s) 157
BsmI GAATGC 2 cut(s) 204, 311
BsnI GGCC 2 cut(s) 29, 110
BspANI GGCC 2 cut(s) 29, 110
BspMI ACCTGC 1 cut(s) 89
Bst4CI ACNGT 2 cut(s) 22, 52
BstC8I GCNNGC 2 cut(s) 31, 96
BstDEI CTNAG 1 cut(s) 200
BstMAI GTCTC 1 cut(s) 157
BstMWI GCNNNNNNNGC 3 cut(s) 39, 116, 283
BstNSI RCATGY 1 cut(s) 316
BsuRI GGCC 2 cut(s) 29, 110
BtrI CACGTC 1 cut(s) 296
BveI ACCTGC 1 cut(s) 89
Cac8I GCNNGC 2 cut(s) 31, 96
Csp6I GTAC 1 cut(s) 130
CviAII CATG 2 cut(s) 106, 313
CviJI RGCY 4 cut(s) 29, 110, 232, 277
CviKI_1 RGCY 4 cut(s) 29, 110, 232, 277
CviQI GTAC 1 cut(s) 130
DdeI CTNAG 1 cut(s) 200
FaeI CATG 2 cut(s) 109, 316
FaiI YATR 5 cut(s) 92, 107, 177, 243, 314
FatI CATG 2 cut(s) 105, 312
FblI GTMKAC 1 cut(s) 196
FspBI CTAG 1 cut(s) 120
HaeIII GGCC 2 cut(s) 29, 110
Hin1II CATG 2 cut(s) 109, 316
HinfI GANTC 1 cut(s) 165
HphI GGTGA 1 cut(s) 113
Hpy166II GTNNAC 2 cut(s) 197, 251
Hpy188I TCNGA 1 cut(s) 162
Hpy188III TCNNGA 1 cut(s) 46
Hpy8I GTNNAC 2 cut(s) 197, 251
Hpy99I CGWCG 1 cut(s) 297
HpyCH4III ACNGT 2 cut(s) 22, 52
HpyCH4IV ACGT 1 cut(s) 295
HpyCH4V TGCA 3 cut(s) 4, 33, 309
HpyF10VI GCNNNNNNNGC 3 cut(s) 39, 116, 283
HpyF3I CTNAG 1 cut(s) 200
HpySE526I ACGT 1 cut(s) 295
Hsp92II CATG 2 cut(s) 109, 316
LpnPI CCDG 8 cut(s) 11, 31, 43, 80, 84, 84, 124, 147
MaeI CTAG 1 cut(s) 120
MaeII ACGT 1 cut(s) 295
MaeIII GTNAC 1 cut(s) 101
MfeI CAATTG 1 cut(s) 13
MluCI AATT 1 cut(s) 13
MlyI GAGTC 1 cut(s) 159
MnlI CCTC 3 cut(s) 46, 72, 184
MseI TTAA 3 cut(s) 54, 147, 237
MunI CAATTG 1 cut(s) 13
Mva1269I GAATGC 2 cut(s) 204, 311
MwoI GCNNNNNNNGC 3 cut(s) 39, 116, 283
NlaIII CATG 2 cut(s) 109, 316
NmuCI GTSAC 1 cut(s) 101
NspI RCATGY 1 cut(s) 316
PaqCI CACCTGC 1 cut(s) 89
PciI ACATGT 1 cut(s) 312
PctI GAATGC 2 cut(s) 204, 311
PflMI CCANNNNNTGG 1 cut(s) 15
PleI GAGTC 1 cut(s) 159
PpsI GAGTC 1 cut(s) 159
PscI ACATGT 1 cut(s) 312
RsaI GTAC 1 cut(s) 131
RsaNI GTAC 1 cut(s) 130
SaqAI TTAA 3 cut(s) 54, 147, 237
SchI GAGTC 1 cut(s) 159
SetI ASST 5 cut(s) 38, 73, 103, 279, 298
Sse9I AATT 1 cut(s) 13
SspMI CTAG 1 cut(s) 120
TaaI ACNGT 2 cut(s) 22, 52
TaiI ACGT 1 cut(s) 298
TaqI TCGA 1 cut(s) 214
TasI AATT 1 cut(s) 13
Tru1I TTAA 3 cut(s) 54, 147, 237
Tru9I TTAA 3 cut(s) 54, 147, 237
TseFI GTSAC 1 cut(s) 101
Tsp45I GTSAC 1 cut(s) 101
TspDTI ATGAA 2 cut(s) 168, 197
TspGWI ACGGA 1 cut(s) 236
Van91I CCANNNNNTGG 1 cut(s) 15
XceI RCATGY 1 cut(s) 316
XmiI GTMKAC 1 cut(s) 196
XspI CTAG 1 cut(s) 120
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.