Rh3CG313700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Reverse (-)
33294708 .. 33301039
6332 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG313700.1

Sequence Viewer

Length: 198 bp
ATGAGAATAACTCTTGATACTACATTTGAATTTCTTAGGCATGTAGTAGCTTTGCTTAGAAAATCAGATGGGATCAGCTTGATGCATGAATATGAGGCTCAAAAGTTTAGGATGGATGAGTTGCTGTTAAAGAGCATTTCTATGAAATGGACGGAGCCGTGGTTAAATCATAACATTGATAAAGCATGTGTGGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.75

Weight (kDa)

6.82

Isoelectric Point (pI)

41.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014149)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 80
AcsI RAATTY 1 cut(s) 29
AgsI TTSAA 1 cut(s) 29
AluBI AGCT 2 cut(s) 50, 78
AluI AGCT 2 cut(s) 50, 78
AlwI GGATC 1 cut(s) 80
ApoI RAATTY 1 cut(s) 29
BccI CCATC 2 cut(s) 62, 106
BceAI ACGGC 1 cut(s) 142
BmiI GGNNCC 1 cut(s) 156
BmsI GCATC 1 cut(s) 72
BplI GAGNNNNNCTC 1 cut(s) 27
BsaJI CCNNGG 1 cut(s) 158
BsaXI ACNNNNNCTCC 2 cut(s) 146, 176
BseDI CCNNGG 1 cut(s) 158
BseGI GGATG 2 cut(s) 117, 121
Bsp143I GATC 1 cut(s) 72
BspLI GGNNCC 1 cut(s) 156
BspPI GGATC 1 cut(s) 80
BssECI CCNNGG 1 cut(s) 158
BssMI GATC 1 cut(s) 72
BstDEI CTNAG 2 cut(s) 35, 56
BstDSI CCRYGG 1 cut(s) 158
BstF5I GGATG 2 cut(s) 117, 121
BstKTI GATC 1 cut(s) 75
BstMBI GATC 1 cut(s) 72
BstNSI RCATGY 2 cut(s) 44, 189
BtgI CCRYGG 1 cut(s) 158
BtsCI GGATG 2 cut(s) 117, 121
CviAII CATG 3 cut(s) 41, 86, 186
CviJI RGCY 4 cut(s) 50, 78, 98, 157
CviKI_1 RGCY 4 cut(s) 50, 78, 98, 157
DdeI CTNAG 2 cut(s) 35, 56
DpnI GATC 1 cut(s) 74
DpnII GATC 1 cut(s) 72
EcoT22I ATGCAT 1 cut(s) 87
FaeI CATG 3 cut(s) 44, 89, 189
FaiI YATR 6 cut(s) 42, 87, 93, 143, 171, 187
FatI CATG 3 cut(s) 40, 85, 185
FokI GGATG 2 cut(s) 124, 128
Hin1II CATG 3 cut(s) 44, 89, 189
Hpy188I TCNGA 1 cut(s) 67
Hpy188III TCNNGA 1 cut(s) 14
HpyCH4V TGCA 1 cut(s) 85
HpyF3I CTNAG 2 cut(s) 35, 56
Hsp92II CATG 3 cut(s) 44, 89, 189
Kzo9I GATC 1 cut(s) 72
LmnI GCTCC 1 cut(s) 154
LweI GCATC 1 cut(s) 72
MalI GATC 1 cut(s) 74
MboI GATC 1 cut(s) 72
MluCI AATT 1 cut(s) 29
MnlI CCTC 1 cut(s) 88
Mph1103I ATGCAT 1 cut(s) 87
MseI TTAA 2 cut(s) 128, 164
MslI CAYNNNNRTG 2 cut(s) 90, 140
NdeII GATC 1 cut(s) 72
NlaIII CATG 3 cut(s) 44, 89, 189
NlaIV GGNNCC 1 cut(s) 156
NsiI ATGCAT 1 cut(s) 87
NspI RCATGY 2 cut(s) 44, 189
PspN4I GGNNCC 1 cut(s) 156
RseI CAYNNNNRTG 2 cut(s) 90, 140
SaqAI TTAA 2 cut(s) 128, 164
Sau3AI GATC 1 cut(s) 72
SetI ASST 2 cut(s) 52, 80
SfaNI GCATC 1 cut(s) 72
SgeI CNNG 5 cut(s) 26, 53, 91, 98, 171
SmiMI CAYNNNNRTG 2 cut(s) 90, 140
Sse9I AATT 1 cut(s) 29
TasI AATT 1 cut(s) 29
Tru1I TTAA 2 cut(s) 128, 164
Tru9I TTAA 2 cut(s) 128, 164
TspDTI ATGAA 2 cut(s) 102, 158
TspGWI ACGGA 1 cut(s) 167
XapI RAATTY 1 cut(s) 29
XceI RCATGY 2 cut(s) 44, 189
Zsp2I ATGCAT 1 cut(s) 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.