Rh4BG172900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Reverse (-)
30881437 .. 30881779
343 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG172900.1

Sequence Viewer

Length: 324 bp
ATGGTTCCTACTAGAAAATTTAAGTCTAGGGCTCAGAAAAGAAAAGAGAAAGAGAGGAGAGAAGCTTTACATAAAACTCAAGTTGGTTCTCTTAAAAAATATTTTAGTAGCAACAAAGAAGAAGCATGTCAAGCTGTGAATGATACTGAAGAGGCAGAAGAGCTAAATCAATCAGAGAATGAGGAAAATAATGAAATTCTCAATGAAGATGTTCACATTATAGAGCCAAATCAGTCAGAGAATGAGGAAATTAATGACATTATCAATGAAGATGTTCACACTACAAGTTCAAGGGAGGAAATTCTTTTCGACATGGATATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

107

Amino Acids

12.56

Weight (kDa)

4.67

Isoelectric Point (pI)

82.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 3 cut(s) 17, 195, 300
AcuI CTGAAG 1 cut(s) 168
AgsI TTSAA 1 cut(s) 291
AluBI AGCT 3 cut(s) 65, 134, 163
AluI AGCT 3 cut(s) 65, 134, 163
ApoI RAATTY 3 cut(s) 17, 195, 300
AseI ATTAAT 1 cut(s) 252
Asp700I GAANNNNTTC 2 cut(s) 210, 273
BanII GRGCYC 1 cut(s) 34
BfaI CTAG 2 cut(s) 12, 27
BmiI GGNNCC 1 cut(s) 6
BpuEI CTTGAG 1 cut(s) 63
BseMII CTCAG 1 cut(s) 47
BseRI GAGGAG 1 cut(s) 70
Bsp1286I GDGCHC 1 cut(s) 34
BspCNI CTCAG 1 cut(s) 46
BspLI GGNNCC 1 cut(s) 6
BspQI GCTCTTC 1 cut(s) 153
Bst6I CTCTTC 2 cut(s) 144, 153
BstDEI CTNAG 1 cut(s) 33
BstMWI GCNNNNNNNGC 1 cut(s) 131
BstNSI RCATGY 1 cut(s) 129
CviAII CATG 2 cut(s) 126, 313
CviJI RGCY 5 cut(s) 32, 65, 134, 163, 226
CviKI_1 RGCY 5 cut(s) 32, 65, 134, 163, 226
DdeI CTNAG 1 cut(s) 33
Eam1104I CTCTTC 2 cut(s) 144, 153
EarI CTCTTC 2 cut(s) 144, 153
Eco24I GRGCYC 1 cut(s) 34
Eco57I CTGAAG 1 cut(s) 168
EcoT38I GRGCYC 1 cut(s) 34
FaeI CATG 2 cut(s) 129, 316
FaiI YATR 6 cut(s) 72, 127, 221, 314, 320, 322
FatI CATG 2 cut(s) 125, 312
FriOI GRGCYC 1 cut(s) 34
FspBI CTAG 2 cut(s) 12, 27
Hin1II CATG 2 cut(s) 129, 316
HindIII AAGCTT 1 cut(s) 63
Hpy166II GTNNAC 2 cut(s) 214, 277
Hpy188I TCNGA 3 cut(s) 36, 175, 238
Hpy8I GTNNAC 2 cut(s) 214, 277
HpyF10VI GCNNNNNNNGC 1 cut(s) 131
HpyF3I CTNAG 1 cut(s) 33
Hsp92II CATG 2 cut(s) 129, 316
LguI GCTCTTC 1 cut(s) 153
MaeI CTAG 2 cut(s) 12, 27
MboII GAAGA 5 cut(s) 131, 161, 170, 218, 281
MhlI GDGCHC 1 cut(s) 34
MluCI AATT 4 cut(s) 17, 195, 249, 300
MnlI CCTC 5 cut(s) 48, 145, 175, 238, 289
MroXI GAANNNNTTC 2 cut(s) 210, 273
MseI TTAA 3 cut(s) 21, 93, 252
MwoI GCNNNNNNNGC 1 cut(s) 131
NlaIII CATG 2 cut(s) 129, 316
NlaIV GGNNCC 1 cut(s) 6
NspI RCATGY 1 cut(s) 129
PciSI GCTCTTC 1 cut(s) 153
PdmI GAANNNNTTC 2 cut(s) 210, 273
PshBI ATTAAT 1 cut(s) 252
PspN4I GGNNCC 1 cut(s) 6
SapI GCTCTTC 1 cut(s) 153
SaqAI TTAA 3 cut(s) 21, 93, 252
SduI GDGCHC 1 cut(s) 34
SetI ASST 3 cut(s) 67, 136, 165
SgeI CNNG 7 cut(s) 24, 39, 92, 138, 143, 297, 303
SmlI CTYRAG 1 cut(s) 78
SmoI CTYRAG 1 cut(s) 78
Sse9I AATT 4 cut(s) 17, 195, 249, 300
SspI AATATT 1 cut(s) 101
SspMI CTAG 2 cut(s) 12, 27
TaqI TCGA 1 cut(s) 309
TasI AATT 4 cut(s) 17, 195, 249, 300
Tru1I TTAA 3 cut(s) 21, 93, 252
Tru9I TTAA 3 cut(s) 21, 93, 252
TspDTI ATGAA 3 cut(s) 207, 219, 282
VspI ATTAAT 1 cut(s) 252
XapI RAATTY 3 cut(s) 17, 195, 300
XceI RCATGY 1 cut(s) 129
XmnI GAANNNNTTC 2 cut(s) 210, 273
XspI CTAG 2 cut(s) 12, 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.