Rh4CG269800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Forward (+)
52400767 .. 52416304
15538 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG269800.1

Sequence Viewer

Length: 414 bp
ATGGCATGTGATATCACGCACAAAAGAGGAAAAAGAATGTTGGAACAAAATGATGCTGAAGGTCTAAATCGTGATGCAGAGATGGAAACAAGAAACAACAGTGAGAATTTTTATGCCATGAGAGGCCAAACTGATAGTGGGGATTTTGGTACAGAGGGAATGCATCAAAGAAGATCAAGAAGACCAAGATGTGTTACTGAACCTGCAATAACAGAGGAAAAATACACTTCTAAACAGTTGAATAGAAGATCAAGAGGGCGAAGACATGTTGCTGAACCTGCAGTAACAGAAAAAAATGACAGCTCTAAACACTTGATTAGAAGAGTTGAACCTGCTGAAGAAAATAACACTCTGTTGTTGAATCAAACTTTTGTTAACAGTGAACATTCGCATGTTCTCAAGTATGATGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

137

Amino Acids

15.93

Weight (kDa)

7.86

Isoelectric Point (pI)

85.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 3 cut(s) 211, 286, 340
AcsI RAATTY 1 cut(s) 106
AcuI CTGAAG 2 cut(s) 78, 357
AfaI GTAC 1 cut(s) 151
AflIII ACRYGT 1 cut(s) 265
AgsI TTSAA 3 cut(s) 241, 329, 361
AluBI AGCT 1 cut(s) 303
AluI AGCT 1 cut(s) 303
AoxI GGCC 1 cut(s) 124
ApoI RAATTY 1 cut(s) 106
BbsI GAAGAC 2 cut(s) 187, 268
BccI CCATC 1 cut(s) 76
BfmI CTRYAG 1 cut(s) 279
BfuAI ACCTGC 3 cut(s) 211, 286, 340
BmsI GCATC 3 cut(s) 43, 64, 172
BpiI GAAGAC 2 cut(s) 187, 268
BpuEI CTTGAG 1 cut(s) 383
BshFI GGCC 1 cut(s) 126
BsmI GAATGC 1 cut(s) 165
BsnI GGCC 1 cut(s) 126
Bsp143I GATC 2 cut(s) 173, 248
BspANI GGCC 1 cut(s) 126
BspMAI CTGCAG 1 cut(s) 283
BspMI ACCTGC 3 cut(s) 211, 286, 340
BssMI GATC 2 cut(s) 173, 248
Bst4CI ACNGT 3 cut(s) 101, 237, 380
Bst6I CTCTTC 1 cut(s) 316
BstKTI GATC 2 cut(s) 176, 251
BstMBI GATC 2 cut(s) 173, 248
BstMWI GCNNNNNNNGC 1 cut(s) 278
BstNSI RCATGY 3 cut(s) 9, 269, 395
BstSFI CTRYAG 1 cut(s) 279
BstV2I GAAGAC 2 cut(s) 187, 268
BsuRI GGCC 1 cut(s) 126
BtsIMutI CAGTG 2 cut(s) 106, 385
BveI ACCTGC 3 cut(s) 211, 286, 340
Csp6I GTAC 1 cut(s) 150
CviAII CATG 4 cut(s) 6, 118, 266, 392
CviJI RGCY 2 cut(s) 126, 303
CviKI_1 RGCY 2 cut(s) 126, 303
CviQI GTAC 1 cut(s) 150
DpnI GATC 2 cut(s) 175, 250
DpnII GATC 2 cut(s) 173, 248
Eam1104I CTCTTC 1 cut(s) 316
EarI CTCTTC 1 cut(s) 316
Eco32I GATATC 1 cut(s) 13
Eco57I CTGAAG 2 cut(s) 78, 357
EcoRV GATATC 1 cut(s) 13
EcoT22I ATGCAT 1 cut(s) 165
FaeI CATG 4 cut(s) 9, 121, 269, 395
FaiI YATR 6 cut(s) 7, 114, 119, 267, 393, 405
FatI CATG 4 cut(s) 5, 117, 265, 391
HaeIII GGCC 1 cut(s) 126
Hin1II CATG 4 cut(s) 9, 121, 269, 395
HincII GTYRAC 1 cut(s) 376
HindII GTYRAC 1 cut(s) 376
HinfI GANTC 1 cut(s) 361
HpaI GTTAAC 1 cut(s) 376
Hpy166II GTNNAC 2 cut(s) 376, 383
Hpy188III TCNNGA 3 cut(s) 71, 177, 252
Hpy8I GTNNAC 2 cut(s) 376, 383
HpyAV CCTTC 1 cut(s) 53
HpyCH4III ACNGT 3 cut(s) 101, 237, 380
HpyCH4V TGCA 4 cut(s) 77, 163, 206, 281
HpyF10VI GCNNNNNNNGC 1 cut(s) 278
Hsp92II CATG 4 cut(s) 9, 121, 269, 395
KspAI GTTAAC 1 cut(s) 376
Kzo9I GATC 2 cut(s) 173, 248
LpnPI CCDG 3 cut(s) 216, 291, 345
LweI GCATC 3 cut(s) 43, 64, 172
MaeIII GTNAC 2 cut(s) 193, 283
MalI GATC 2 cut(s) 175, 250
MboI GATC 2 cut(s) 173, 248
MboII GAAGA 6 cut(s) 183, 192, 258, 273, 333, 350
MluCI AATT 1 cut(s) 106
MmeI TCCRAC 1 cut(s) 21
MnlI CCTC 5 cut(s) 20, 116, 148, 208, 248
Mph1103I ATGCAT 1 cut(s) 165
MseI TTAA 1 cut(s) 375
MslI CAYNNNNRTG 1 cut(s) 390
Mva1269I GAATGC 1 cut(s) 165
MwoI GCNNNNNNNGC 1 cut(s) 278
NdeII GATC 2 cut(s) 173, 248
NlaIII CATG 4 cut(s) 9, 121, 269, 395
NsiI ATGCAT 1 cut(s) 165
NspI RCATGY 3 cut(s) 9, 269, 395
PciI ACATGT 1 cut(s) 265
PctI GAATGC 1 cut(s) 165
PfeI GAWTC 1 cut(s) 361
PscI ACATGT 1 cut(s) 265
PstI CTGCAG 1 cut(s) 283
RsaI GTAC 1 cut(s) 151
RsaNI GTAC 1 cut(s) 150
RseI CAYNNNNRTG 1 cut(s) 390
SaqAI TTAA 1 cut(s) 375
Sau3AI GATC 2 cut(s) 173, 248
SetI ASST 5 cut(s) 64, 205, 280, 305, 334
SfaNI GCATC 3 cut(s) 43, 64, 172
SfcI CTRYAG 1 cut(s) 279
SmiMI CAYNNNNRTG 1 cut(s) 390
SmlI CTYRAG 1 cut(s) 398
SmoI CTYRAG 1 cut(s) 398
Sse9I AATT 1 cut(s) 106
TaaI ACNGT 3 cut(s) 101, 237, 380
TasI AATT 1 cut(s) 106
TfiI GAWTC 1 cut(s) 361
Tru1I TTAA 1 cut(s) 375
Tru9I TTAA 1 cut(s) 375
TscAI CASTG 2 cut(s) 106, 385
TspRI CASTG 2 cut(s) 106, 385
XapI RAATTY 1 cut(s) 106
XceI RCATGY 3 cut(s) 9, 269, 395
XcmI CCANNNNNNNNNTGG 1 cut(s) 134
Zsp2I ATGCAT 1 cut(s) 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.