Rh5AG084400

Olee1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0009996
Physical Location & Seq
Forward (+)
7259708 .. 7260006
299 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG084400.1

Sequence Viewer

Length: 216 bp
ATGGCCAAGTCTAGCATTATCATCTTTGCTTCAGCCCTTTGCTTCTTGTCCGTCATCGACAATGCTTACAGCGAAGACAAGACAACACTCCAGGTTGAAGGCGTAGTCTTTTGTGACAGCTGCCGCATCCAGTTCATCACCAGAATCAGCGAGCTTATACAAGGTGCAAAGGTGAAGTTGGAATGCAAGGACCGCGAAAGTGGTAGCATAACATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pollen_Ole_e_I

Protein Analysis

71

Amino Acids

7.82

Weight (kDa)

5.21

Isoelectric Point (pI)

37.58

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pollen_Ole_e_1 PF01190 32 - 66 9.7e-08 Pollen protein Ole e 1 like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009996)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G29140 AT4G18596 AT4G18596 AT5G45880
fragaria_vesca FvH4_3g07791
malus_domestica MD05G1301300.v1.1 MD10G1280200.v1.1
prunus_persica Prupe.4G061100_v2.0.a1
pyrus_communis pycom05g27910
rosa_chinensis RchiOBHm_Chr5g0010771
rosa_laevigata RLG00000031778
rosa_multiflora Rmu_sc0000109.1_g000021
rosa_roxburghii Rroxscaffold_1G00065610
rosa_rugosa Rorug04G0452100
rosa_samantha Rh5AG084000 Rh5AG084400 Rh5BG079200 Rh5CG092000 Rh5DG079400
rosa_wichuraiana Rw0G000580 Rw0G022280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 195
AciI CCGC 2 cut(s) 124, 193
AcoI YGGCCR 1 cut(s) 3
AcuI CTGAAG 1 cut(s) 15
AgsI TTSAA 1 cut(s) 98
AjnI CCWGG 1 cut(s) 90
AluBI AGCT 2 cut(s) 120, 154
AluI AGCT 2 cut(s) 120, 154
AoxI GGCC 1 cut(s) 3
ApeKI GCWGC 1 cut(s) 120
AspS9I GGNCC 1 cut(s) 190
AsuHPI GGTGA 2 cut(s) 130, 184
AvaII GGWCC 1 cut(s) 190
BalI TGGCCA 1 cut(s) 5
BbsI GAAGAC 1 cut(s) 81
BbvI GCAGC 1 cut(s) 107
BciT130I CCWGG 1 cut(s) 92
BfaI CTAG 1 cut(s) 12
BisI GCNGC 2 cut(s) 121, 124
BlsI GCNGC 2 cut(s) 122, 125
Bme1390I CCNGG 1 cut(s) 92
Bme18I GGWCC 1 cut(s) 190
BmgT120I GGNCC 1 cut(s) 190
BmrFI CCNGG 1 cut(s) 92
BmsI GCATC 1 cut(s) 135
BpiI GAAGAC 1 cut(s) 81
BpmI CTGGAG 1 cut(s) 74
Bse1I ACTGG 1 cut(s) 130
BseBI CCWGG 1 cut(s) 92
BseGI GGATG 1 cut(s) 126
BseNI ACTGG 1 cut(s) 130
BseXI GCAGC 1 cut(s) 107
Bsh1236I CGCG 1 cut(s) 195
BshFI GGCC 1 cut(s) 5
BsmI GAATGC 1 cut(s) 188
BsnI GGCC 1 cut(s) 5
BspACI CCGC 2 cut(s) 124, 193
BspANI GGCC 1 cut(s) 5
BspFNI CGCG 1 cut(s) 195
BsrI ACTGG 1 cut(s) 130
Bst2UI CCWGG 1 cut(s) 92
BstC8I GCNNGC 1 cut(s) 152
BstF5I GGATG 1 cut(s) 126
BstFNI CGCG 1 cut(s) 195
BstMWI GCNNNNNNNGC 1 cut(s) 192
BstNI CCWGG 1 cut(s) 92
BstSCI CCNGG 1 cut(s) 90
BstUI CGCG 1 cut(s) 195
BstV1I GCAGC 1 cut(s) 107
BstV2I GAAGAC 1 cut(s) 81
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 1 cut(s) 126
Cac8I GCNNGC 1 cut(s) 152
Cfr13I GGNCC 1 cut(s) 190
CviJI RGCY 4 cut(s) 5, 35, 120, 154
CviKI_1 RGCY 4 cut(s) 5, 35, 120, 154
EaeI YGGCCR 1 cut(s) 3
Eco47I GGWCC 1 cut(s) 190
Eco57I CTGAAG 1 cut(s) 15
EcoRII CCWGG 1 cut(s) 90
FaiI YATR 3 cut(s) 158, 209, 214
Fnu4HI GCNGC 2 cut(s) 121, 124
FokI GGATG 1 cut(s) 113
Fsp4HI GCNGC 2 cut(s) 121, 124
FspBI CTAG 1 cut(s) 12
GluI GCNGC 2 cut(s) 121, 124
GsuI CTGGAG 1 cut(s) 74
HaeIII GGCC 1 cut(s) 5
HinfI GANTC 1 cut(s) 144
HphI GGTGA 2 cut(s) 130, 184
HpyAV CCTTC 1 cut(s) 92
HpyCH4V TGCA 2 cut(s) 167, 186
HpyF10VI GCNNNNNNNGC 1 cut(s) 192
LpnPI CCDG 4 cut(s) 77, 104, 143, 154
Lsp1109I GCAGC 1 cut(s) 107
LweI GCATC 1 cut(s) 135
MaeI CTAG 1 cut(s) 12
MaeIII GTNAC 1 cut(s) 113
MboII GAAGA 1 cut(s) 86
MlsI TGGCCA 1 cut(s) 5
MluNI TGGCCA 1 cut(s) 5
MmeI TCCRAC 1 cut(s) 159
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
Msp20I TGGCCA 1 cut(s) 5
MspA1I CMGCKG 1 cut(s) 120
MspR9I CCNGG 1 cut(s) 92
Mva1269I GAATGC 1 cut(s) 188
MvaI CCWGG 1 cut(s) 92
MvnI CGCG 1 cut(s) 195
MwoI GCNNNNNNNGC 1 cut(s) 192
NmuCI GTSAC 1 cut(s) 113
PctI GAATGC 1 cut(s) 188
PfeI GAWTC 1 cut(s) 144
PkrI GCNGC 2 cut(s) 122, 125
Psp6I CCWGG 1 cut(s) 90
PspGI CCWGG 1 cut(s) 90
PspPI GGNCC 1 cut(s) 190
PvuII CAGCTG 1 cut(s) 120
SatI GCNGC 2 cut(s) 121, 124
Sau96I GGNCC 1 cut(s) 190
ScrFI CCNGG 1 cut(s) 92
SetI ASST 5 cut(s) 96, 122, 156, 166, 174
SfaNI GCATC 1 cut(s) 135
SinI GGWCC 1 cut(s) 190
SsiI CCGC 2 cut(s) 124, 193
SspMI CTAG 1 cut(s) 12
StyD4I CCNGG 1 cut(s) 90
TaqI TCGA 1 cut(s) 57
TauI GCSGC 1 cut(s) 126
TfiI GAWTC 1 cut(s) 144
TseFI GTSAC 1 cut(s) 113
TseI GCWGC 1 cut(s) 120
Tsp45I GTSAC 1 cut(s) 113
TspDTI ATGAA 1 cut(s) 124
TspGWI ACGGA 1 cut(s) 40
VpaK11BI GGWCC 1 cut(s) 190
XspI CTAG 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.