Rh5AG164400

source UniProtKB

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Forward (+)
17725358 .. 17746838
21481 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG164400.1

Sequence Viewer

Length: 300 bp
ATGTCAAGGATGACAACGGGCAGGATTCTAAAGAAGAAACTTATAGTCCAATTTGATAAGAATGGGGATCCAATAGGGAATAATGCAGATGCACTACAATCCTACATCGGCGTTTTGGCAAGAACCAATATCCCAATTTCAATAGTATCTTGGCCTAATGTATCGAAGACAAAAAAAAACAGTCTATGGGAGAACGTTTTGATTTTGAAGATTGTATCTTTAGTTATGTATCTGTTTTGTATCTCTTTTGCGACTGTTGCTGTGATTGTTGCGGTGAAAATTGTGTACCACTTGGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

99

Amino Acids

11.06

Weight (kDa)

9.87

Isoelectric Point (pI)

22.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 272
AclI AACGTT 1 cut(s) 195
AclWI GGATC 2 cut(s) 62, 75
AfaI GTAC 1 cut(s) 287
AgsI TTSAA 2 cut(s) 141, 208
AlwI GGATC 2 cut(s) 62, 75
AoxI GGCC 1 cut(s) 152
AsuHPI GGTGA 1 cut(s) 286
BamHI GGATCC 1 cut(s) 67
BbsI GAAGAC 1 cut(s) 173
BmiI GGNNCC 1 cut(s) 69
BmsI GCATC 1 cut(s) 79
BpiI GAAGAC 1 cut(s) 173
BseGI GGATG 1 cut(s) 15
BshFI GGCC 1 cut(s) 154
BsnI GGCC 1 cut(s) 154
Bsp143I GATC 1 cut(s) 67
BspACI CCGC 1 cut(s) 272
BspANI GGCC 1 cut(s) 154
BspLI GGNNCC 1 cut(s) 69
BspPI GGATC 2 cut(s) 62, 75
BssMI GATC 1 cut(s) 67
Bst4CI ACNGT 2 cut(s) 182, 256
BstF5I GGATG 1 cut(s) 15
BstKTI GATC 1 cut(s) 70
BstMBI GATC 1 cut(s) 67
BstMWI GCNNNNNNNGC 1 cut(s) 257
BstV2I GAAGAC 1 cut(s) 173
BstX2I RGATCY 1 cut(s) 67
BstYI RGATCY 1 cut(s) 67
BsuRI GGCC 1 cut(s) 154
BtsCI GGATG 1 cut(s) 15
Csp6I GTAC 1 cut(s) 286
CviJI RGCY 1 cut(s) 154
CviKI_1 RGCY 1 cut(s) 154
CviQI GTAC 1 cut(s) 286
DpnI GATC 1 cut(s) 69
DpnII GATC 1 cut(s) 67
FaiI YATR 3 cut(s) 44, 187, 227
FokI GGATG 1 cut(s) 22
HaeIII GGCC 1 cut(s) 154
HinfI GANTC 1 cut(s) 25
HphI GGTGA 1 cut(s) 286
Hpy166II GTNNAC 1 cut(s) 286
Hpy8I GTNNAC 1 cut(s) 286
HpyCH4III ACNGT 2 cut(s) 182, 256
HpyCH4IV ACGT 1 cut(s) 195
HpyCH4V TGCA 2 cut(s) 86, 92
HpyF10VI GCNNNNNNNGC 1 cut(s) 257
HpySE526I ACGT 1 cut(s) 195
Kzo9I GATC 1 cut(s) 67
LpnPI CCDG 1 cut(s) 7
LweI GCATC 1 cut(s) 79
MaeII ACGT 1 cut(s) 195
MalI GATC 1 cut(s) 69
MboI GATC 1 cut(s) 67
MboII GAAGA 3 cut(s) 46, 178, 220
MflI RGATCY 1 cut(s) 67
MluCI AATT 3 cut(s) 50, 135, 279
MwoI GCNNNNNNNGC 1 cut(s) 257
NdeII GATC 1 cut(s) 67
NlaIV GGNNCC 1 cut(s) 69
PfeI GAWTC 1 cut(s) 25
Psp1406I AACGTT 1 cut(s) 195
PspN4I GGNNCC 1 cut(s) 69
PsuI RGATCY 1 cut(s) 67
RsaI GTAC 1 cut(s) 287
RsaNI GTAC 1 cut(s) 286
Sau3AI GATC 1 cut(s) 67
SetI ASST 1 cut(s) 198
SfaNI GCATC 1 cut(s) 79
SgeI CNNG 5 cut(s) 18, 30, 34, 132, 162
Sse9I AATT 3 cut(s) 50, 135, 279
SsiI CCGC 1 cut(s) 272
TaaI ACNGT 2 cut(s) 182, 256
TaiI ACGT 1 cut(s) 198
TaqI TCGA 1 cut(s) 164
TasI AATT 3 cut(s) 50, 135, 279
TfiI GAWTC 1 cut(s) 25
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.