Rh5AG332100

Cleavage site for pathogenic type III effector avirulence factor Avr

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Forward (+)
52986458 .. 52989472
3015 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG332100.1

Sequence Viewer

Length: 333 bp
ATGGGACACCGGGAGGAGGGAAATGGTCGGAAGTCAATTCCTCAATTTGGAGGATGGGAACAAAACGCCACAGTAGAGCCTACCAGCTATACTGTGGTGTTTAGTCAAGCTCGTGCTAACCGGAAGCAAAATAAGACTGACTTGACCGAGTTCAAGCGCAACAGCCTTGGAAATGAACATGAATTAATGACTGCTCAAGGCCATCATGATCATCGTCATCATTCTGATGATTCTGTTACGGTAACACTATCTGTTTCGATCTCCAATTATTCCTTACATATCATCTTAGTAGTTGATTTAATTTTTCTTTTTTCTCTCTTTTCATGCAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

110

Amino Acids

12.51

Weight (kDa)

6.7

Isoelectric Point (pI)

34.62

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AvrRpt-cleavage PF05627 9 - 42 1.6e-09 Cleavage site for pathogenic type III effector avirulence factor Avr
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012034)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 16, 47
AgsI TTSAA 1 cut(s) 154
AluBI AGCT 2 cut(s) 87, 110
AluI AGCT 2 cut(s) 87, 110
AoxI GGCC 1 cut(s) 199
AseI ATTAAT 1 cut(s) 185
AspLEI GCGC 1 cut(s) 159
AsuC2I CCSGG 1 cut(s) 11
BauI CACGAG 1 cut(s) 111
BccI CCATC 2 cut(s) 48, 210
BclI TGATCA 1 cut(s) 208
BcnI CCSGG 1 cut(s) 11
Bme1390I CCNGG 1 cut(s) 11
BmrFI CCNGG 1 cut(s) 11
BpuEI CTTGAG 1 cut(s) 180
BpuMI CCSGG 1 cut(s) 11
BsaJI CCNNGG 1 cut(s) 166
BsaWI WCCGGW 1 cut(s) 120
Bsc4I CCNNNNNNNGG 2 cut(s) 16, 47
BseDI CCNNGG 1 cut(s) 166
BseGI GGATG 1 cut(s) 59
BseLI CCNNNNNNNGG 2 cut(s) 16, 47
BseRI GAGGAG 1 cut(s) 29
BshFI GGCC 1 cut(s) 201
BsiSI CCGG 2 cut(s) 10, 121
BslFI GGGAC 1 cut(s) 18
BslI CCNNNNNNNGG 2 cut(s) 16, 47
BsmFI GGGAC 1 cut(s) 18
BsnI GGCC 1 cut(s) 201
Bsp143I GATC 2 cut(s) 208, 258
BspANI GGCC 1 cut(s) 201
BspHI TCATGA 1 cut(s) 205
BssECI CCNNGG 1 cut(s) 166
BssMI GATC 2 cut(s) 208, 258
BssSI CACGAG 1 cut(s) 111
BssT1I CCWWGG 1 cut(s) 166
Bst2BI CACGAG 1 cut(s) 111
Bst4CI ACNGT 3 cut(s) 73, 94, 241
BstDEI CTNAG 1 cut(s) 286
BstF5I GGATG 1 cut(s) 59
BstHHI GCGC 1 cut(s) 159
BstKTI GATC 2 cut(s) 211, 261
BstMBI GATC 2 cut(s) 208, 258
BstSCI CCNGG 1 cut(s) 9
BsuRI GGCC 1 cut(s) 201
BtsCI GGATG 1 cut(s) 59
CciI TCATGA 1 cut(s) 205
CfoI GCGC 1 cut(s) 159
CviAII CATG 3 cut(s) 179, 206, 324
CviJI RGCY 5 cut(s) 79, 87, 110, 165, 201
CviKI_1 RGCY 5 cut(s) 79, 87, 110, 165, 201
DdeI CTNAG 1 cut(s) 286
DpnI GATC 2 cut(s) 210, 260
DpnII GATC 2 cut(s) 208, 258
Eco130I CCWWGG 1 cut(s) 166
EcoT14I CCWWGG 1 cut(s) 166
ErhI CCWWGG 1 cut(s) 166
FaeI CATG 3 cut(s) 182, 209, 327
FaiI YATR 5 cut(s) 90, 180, 207, 279, 325
FalI AAGNNNNNCTT 2 cut(s) 125, 157
FaqI GGGAC 1 cut(s) 18
FatI CATG 3 cut(s) 178, 205, 323
FbaI TGATCA 1 cut(s) 208
FokI GGATG 1 cut(s) 66
GlaI GCGC 1 cut(s) 158
HaeIII GGCC 1 cut(s) 201
HapII CCGG 2 cut(s) 10, 121
HhaI GCGC 1 cut(s) 159
Hin1II CATG 3 cut(s) 182, 209, 327
Hin6I GCGC 1 cut(s) 157
HinP1I GCGC 1 cut(s) 157
HinfI GANTC 1 cut(s) 230
HpaII CCGG 2 cut(s) 10, 121
Hpy188I TCNGA 2 cut(s) 30, 226
Hpy188III TCNNGA 1 cut(s) 206
HpyCH4III ACNGT 3 cut(s) 73, 94, 241
HpyCH4V TGCA 1 cut(s) 327
HpyF3I CTNAG 1 cut(s) 286
Hsp92II CATG 3 cut(s) 182, 209, 327
HspAI GCGC 1 cut(s) 157
Ksp22I TGATCA 1 cut(s) 208
Kzo9I GATC 2 cut(s) 208, 258
LpnPI CCDG 3 cut(s) 23, 97, 134
MaeIII GTNAC 2 cut(s) 235, 241
MalI GATC 2 cut(s) 210, 260
MboI GATC 2 cut(s) 208, 258
MluCI AATT 5 cut(s) 36, 44, 182, 265, 300
MmeI TCCRAC 1 cut(s) 8
MnlI CCTC 4 cut(s) 7, 10, 44, 51
MseI TTAA 2 cut(s) 185, 299
MslI CAYNNNNRTG 2 cut(s) 225, 328
MspI CCGG 2 cut(s) 10, 121
MspR9I CCNGG 1 cut(s) 11
NciI CCSGG 1 cut(s) 11
NdeII GATC 2 cut(s) 208, 258
NlaIII CATG 3 cut(s) 182, 209, 327
PagI TCATGA 1 cut(s) 205
PfeI GAWTC 1 cut(s) 230
PshBI ATTAAT 1 cut(s) 185
RseI CAYNNNNRTG 2 cut(s) 225, 328
SaqAI TTAA 2 cut(s) 185, 299
Sau3AI GATC 2 cut(s) 208, 258
ScrFI CCNGG 1 cut(s) 11
SetI ASST 2 cut(s) 89, 112
SmiMI CAYNNNNRTG 2 cut(s) 225, 328
SmlI CTYRAG 1 cut(s) 195
SmoI CTYRAG 1 cut(s) 195
Sse9I AATT 5 cut(s) 36, 44, 182, 265, 300
StyD4I CCNGG 1 cut(s) 9
StyI CCWWGG 1 cut(s) 166
TaaI ACNGT 3 cut(s) 73, 94, 241
TaqI TCGA 1 cut(s) 257
TaqII GACCGA 1 cut(s) 161
TasI AATT 5 cut(s) 36, 44, 182, 265, 300
TfiI GAWTC 1 cut(s) 230
Tru1I TTAA 2 cut(s) 185, 299
Tru9I TTAA 2 cut(s) 185, 299
TspDTI ATGAA 3 cut(s) 189, 195, 312
VspI ATTAAT 1 cut(s) 185
XcmI CCANNNNNNNNNTGG 1 cut(s) 91
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.