Rh5BG317300

Regulates membrane-cell wall junctions and localized cell wall deposition. Required for establishment of the Casparian strip membrane domain (CSD) and the subsequent formation of Casparian strips, a cell wall modification of the root endodermis that determines an apoplastic barrier between the intraorganismal apoplasm and the extraorganismal apoplasm and prevents lateral diffusion (By similarity)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
42261678 .. 42273884
12207 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG317300.1

Sequence Viewer

Length: 243 bp
ATGGTTCGTCCATTTACAGGCTTGGAGTATGTGATGATTGCTCTAGTGGTAGCTGCTGCCGGAGCTTCTTCTGCGATAATGTACTTGGCTCATAACGGAAATTTGGACTCGAACTGGCTTGCTATTTGTATGCAATATACTAACTTTTGCCAGGGACTAAGTGGGGCTGTTGTGGCTTCATTTGTCGCTGCGGTCTTTTTCATGTTGCTGGTTGTGAATTCTACTTTTGCTCTTAAGAAGTAA

Protein Analysis

80

Amino Acids

8.54

Weight (kDa)

7.8

Isoelectric Point (pI)

15.4

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CASP_dom PF04535 8 - 66 3.4e-16 Casparian strip membrane protein domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012760)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 191
AcsI RAATTY 2 cut(s) 100, 217
AfaI GTAC 1 cut(s) 83
AfiI CCNNNNNNNGG 1 cut(s) 17
AflII CTTAAG 1 cut(s) 233
AjnI CCWGG 1 cut(s) 150
AluBI AGCT 2 cut(s) 53, 65
AluI AGCT 2 cut(s) 53, 65
ApeKI GCWGC 3 cut(s) 53, 56, 188
ApoI RAATTY 2 cut(s) 100, 217
BbvI GCAGC 3 cut(s) 40, 43, 175
BciT130I CCWGG 1 cut(s) 152
BfaI CTAG 1 cut(s) 44
BfrI CTTAAG 1 cut(s) 233
BisI GCNGC 3 cut(s) 54, 57, 189
BlsI GCNGC 3 cut(s) 55, 58, 190
Bme1390I CCNGG 1 cut(s) 152
BmrFI CCNGG 1 cut(s) 152
BsaJI CCNNGG 1 cut(s) 151
Bsc4I CCNNNNNNNGG 1 cut(s) 17
Bse1I ACTGG 1 cut(s) 119
BseBI CCWGG 1 cut(s) 152
BseDI CCNNGG 1 cut(s) 151
BseLI CCNNNNNNNGG 1 cut(s) 17
BseNI ACTGG 1 cut(s) 119
BseXI GCAGC 3 cut(s) 40, 43, 175
BsiSI CCGG 1 cut(s) 60
BslFI GGGAC 1 cut(s) 168
BslI CCNNNNNNNGG 1 cut(s) 17
BsmFI GGGAC 1 cut(s) 168
BspACI CCGC 1 cut(s) 191
BspTI CTTAAG 1 cut(s) 233
BsrI ACTGG 1 cut(s) 119
BssECI CCNNGG 1 cut(s) 151
Bst2UI CCWGG 1 cut(s) 152
BstAFI CTTAAG 1 cut(s) 233
BstC8I GCNNGC 1 cut(s) 120
BstDEI CTNAG 1 cut(s) 158
BstMWI GCNNNNNNNGC 3 cut(s) 62, 71, 173
BstNI CCWGG 1 cut(s) 152
BstSCI CCNGG 1 cut(s) 150
BstV1I GCAGC 3 cut(s) 40, 43, 175
Cac8I GCNNGC 1 cut(s) 120
Csp6I GTAC 1 cut(s) 82
CviAII CATG 1 cut(s) 202
CviJI RGCY 7 cut(s) 21, 53, 65, 89, 118, 167, 176
CviKI_1 RGCY 7 cut(s) 21, 53, 65, 89, 118, 167, 176
CviQI GTAC 1 cut(s) 82
DdeI CTNAG 1 cut(s) 158
EcoRI GAATTC 1 cut(s) 217
EcoRII CCWGG 1 cut(s) 150
FaeI CATG 1 cut(s) 205
FaiI YATR 5 cut(s) 30, 93, 131, 138, 203
FaqI GGGAC 1 cut(s) 168
FatI CATG 1 cut(s) 201
Fnu4HI GCNGC 3 cut(s) 54, 57, 189
Fsp4HI GCNGC 3 cut(s) 54, 57, 189
FspBI CTAG 1 cut(s) 44
GluI GCNGC 3 cut(s) 54, 57, 189
HapII CCGG 1 cut(s) 60
Hin1II CATG 1 cut(s) 205
HinfI GANTC 1 cut(s) 107
HpaII CCGG 1 cut(s) 60
HpyCH4V TGCA 1 cut(s) 133
HpyF10VI GCNNNNNNNGC 3 cut(s) 62, 71, 173
HpyF3I CTNAG 1 cut(s) 158
Hsp92II CATG 1 cut(s) 205
LmnI GCTCC 1 cut(s) 62
LpnPI CCDG 6 cut(s) 3, 73, 100, 137, 164, 194
Lsp1109I GCAGC 3 cut(s) 40, 43, 175
MaeI CTAG 1 cut(s) 44
MboII GAAGA 1 cut(s) 60
MluCI AATT 2 cut(s) 100, 217
MlyI GAGTC 1 cut(s) 101
MseI TTAA 1 cut(s) 234
MspCI CTTAAG 1 cut(s) 233
MspI CCGG 1 cut(s) 60
MspR9I CCNGG 1 cut(s) 152
MvaI CCWGG 1 cut(s) 152
MwoI GCNNNNNNNGC 3 cut(s) 62, 71, 173
NlaIII CATG 1 cut(s) 205
PkrI GCNGC 3 cut(s) 55, 58, 190
PleI GAGTC 1 cut(s) 101
PpsI GAGTC 1 cut(s) 101
Psp6I CCWGG 1 cut(s) 150
PspGI CCWGG 1 cut(s) 150
RsaI GTAC 1 cut(s) 83
RsaNI GTAC 1 cut(s) 82
SaqAI TTAA 1 cut(s) 234
SatI GCNGC 3 cut(s) 54, 57, 189
SchI GAGTC 1 cut(s) 101
ScrFI CCNGG 1 cut(s) 152
SetI ASST 2 cut(s) 55, 67
SmlI CTYRAG 1 cut(s) 233
SmoI CTYRAG 1 cut(s) 233
Sse9I AATT 2 cut(s) 100, 217
SsiI CCGC 1 cut(s) 191
SspMI CTAG 1 cut(s) 44
StyD4I CCNGG 1 cut(s) 150
TaqI TCGA 1 cut(s) 110
TasI AATT 2 cut(s) 100, 217
TatI WGTACW 1 cut(s) 81
Tru1I TTAA 1 cut(s) 234
Tru9I TTAA 1 cut(s) 234
TseI GCWGC 3 cut(s) 53, 56, 188
TspDTI ATGAA 2 cut(s) 168, 190
TspGWI ACGGA 1 cut(s) 111
Vha464I CTTAAG 1 cut(s) 233
XapI RAATTY 2 cut(s) 100, 217
XcmI CCANNNNNNNNNTGG 1 cut(s) 158
XspI CTAG 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.