Rh5CG034400

Exonuclease mut-7 homolog

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Forward (+)
2206241 .. 2206571
331 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG034400.1

Sequence Viewer

Length: 210 bp
ATGCCCCTGATAACCCCCTTCGTCTCCTCCATCGGTTCTCCTGAGTTCACTCACCTAACCACCTCCCTGACTCACTCCGCCATCATTGTCCTCGACGCCGAGTGGAAGCCCCTCCGCTCCCACCACCCCACTTACCTAACCGTCCCTCTCCTCCAACTCGCCTGCGAACTCACCGGCGACTCGGTCTTCGTCGTCTTCCTGCTCGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

69

Amino Acids

7.62

Weight (kDa)

5.29

Isoelectric Point (pI)

50.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 117
AciI CCGC 2 cut(s) 78, 115
AcyI GRCGYC 1 cut(s) 96
Alw26I GTCTC 1 cut(s) 28
ArsI GACNNNNNNTTYG 2 cut(s) 170, 202
AsuHPI GGTGA 2 cut(s) 44, 163
BbsI GAAGAC 2 cut(s) 178, 187
BccI CCATC 2 cut(s) 38, 89
BcoDI GTCTC 1 cut(s) 28
BfaI CTAG 1 cut(s) 208
BpiI GAAGAC 2 cut(s) 178, 187
BsaHI GRCGYC 1 cut(s) 96
Bse118I RCCGGY 1 cut(s) 173
BseMII CTCAG 1 cut(s) 33
BseRI GAGGAG 2 cut(s) 16, 140
BsiSI CCGG 1 cut(s) 174
BslFI GGGAC 1 cut(s) 128
BsmAI GTCTC 1 cut(s) 28
BsmBI CGTCTC 1 cut(s) 28
BsmFI GGGAC 1 cut(s) 128
BspACI CCGC 2 cut(s) 78, 115
BspCNI CTCAG 1 cut(s) 34
BsrBI CCGCTC 1 cut(s) 117
BsrFI RCCGGY 1 cut(s) 173
BssAI RCCGGY 1 cut(s) 173
BssNI GRCGYC 1 cut(s) 96
Bst4CI ACNGT 1 cut(s) 142
BstACI GRCGYC 1 cut(s) 96
BstC8I GCNNGC 1 cut(s) 163
BstDEI CTNAG 1 cut(s) 42
BstMAI GTCTC 1 cut(s) 28
BstV2I GAAGAC 2 cut(s) 178, 187
Cac8I GCNNGC 1 cut(s) 163
Cfr10I RCCGGY 1 cut(s) 173
CseI GACGC 1 cut(s) 104
CviJI RGCY 1 cut(s) 109
CviKI_1 RGCY 1 cut(s) 109
DdeI CTNAG 1 cut(s) 42
EciI GGCGGA 1 cut(s) 67
Esp3I CGTCTC 1 cut(s) 28
FaqI GGGAC 1 cut(s) 128
FspBI CTAG 1 cut(s) 208
HapII CCGG 1 cut(s) 174
HgaI GACGC 1 cut(s) 104
Hin1I GRCGYC 1 cut(s) 96
HinfI GANTC 2 cut(s) 70, 179
HpaII CCGG 1 cut(s) 174
HphI GGTGA 2 cut(s) 44, 163
Hpy166II GTNNAC 1 cut(s) 48
Hpy188III TCNNGA 1 cut(s) 41
Hpy8I GTNNAC 1 cut(s) 48
Hpy99I CGWCG 2 cut(s) 98, 194
HpyAV CCTTC 1 cut(s) 28
HpyCH4III ACNGT 1 cut(s) 142
HpyF3I CTNAG 1 cut(s) 42
Hsp92I GRCGYC 1 cut(s) 96
LmnI GCTCC 1 cut(s) 122
LpnPI CCDG 5 cut(s) 20, 54, 80, 175, 187
MaeI CTAG 1 cut(s) 208
MbiI CCGCTC 1 cut(s) 117
MboII GAAGA 2 cut(s) 178, 187
MlyI GAGTC 2 cut(s) 64, 173
MmeI TCCRAC 1 cut(s) 178
MnlI CCTC 6 cut(s) 37, 73, 101, 122, 156, 161
MspI CCGG 1 cut(s) 174
NmeAIII GCCGAG 1 cut(s) 124
PflFI GACNNNGTC 1 cut(s) 182
PleI GAGTC 2 cut(s) 64, 173
PpsI GAGTC 2 cut(s) 64, 173
PsyI GACNNNGTC 1 cut(s) 182
SchI GAGTC 2 cut(s) 64, 173
SetI ASST 3 cut(s) 57, 65, 138
SgeI CNNG 9 cut(s) 19, 53, 79, 104, 112, 170, 174, 186, 193
SgrAI CRCCGGYG 1 cut(s) 173
SsiI CCGC 2 cut(s) 78, 115
SspMI CTAG 1 cut(s) 208
TaaI ACNGT 1 cut(s) 142
TaqI TCGA 2 cut(s) 93, 204
TaqII GACCGA 1 cut(s) 172
Tth111I GACNNNGTC 1 cut(s) 182
XspI CTAG 1 cut(s) 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.