Rh5CG278900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Reverse (-)
30375502 .. 30375756
255 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG278900.1

Sequence Viewer

Length: 174 bp
ATGGCTGTCGGGCTCCTACGTTGGGCAAACGACGTCGTTCAAGACGCCGGTGTGGAGAAACTCAACCAGACGGCCGAAGTGAGCGGAGGAGATGTTGAGGTCGAGGGAGAGATCTCCTCTGGTCCAACGGCGCTAGGAAGTTGGTCTTGGCCTTGTTGCCACGGAGAGACCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

57

Amino Acids

5.94

Weight (kDa)

4.05

Isoelectric Point (pI)

30.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 36
AccBSI CCGCTC 1 cut(s) 84
AciI CCGC 1 cut(s) 84
AcoI YGGCCR 1 cut(s) 72
AcyI GRCGYC 2 cut(s) 33, 45
AfiI CCNNNNNNNGG 1 cut(s) 22
AgsI TTSAA 1 cut(s) 41
AjuI GAANNNNNNNTTGG 2 cut(s) 130, 162
Alw26I GTCTC 1 cut(s) 161
AoxI GGCC 2 cut(s) 72, 149
AspLEI GCGC 1 cut(s) 133
AspS9I GGNCC 1 cut(s) 122
AvaII GGWCC 1 cut(s) 122
BanII GRGCYC 1 cut(s) 15
BceAI ACGGC 2 cut(s) 87, 144
BcoDI GTCTC 1 cut(s) 161
BfaI CTAG 2 cut(s) 134, 172
BfoI RGCGCY 1 cut(s) 134
BglII AGATCT 1 cut(s) 111
Bme18I GGWCC 1 cut(s) 122
BmgT120I GGNCC 1 cut(s) 122
BmiI GGNNCC 1 cut(s) 14
BplI GAGNNNNNCTC 2 cut(s) 101, 133
BsaHI GRCGYC 2 cut(s) 33, 45
BsaI GGTCTC 1 cut(s) 161
BsaJI CCNNGG 1 cut(s) 160
BsaXI ACNNNNNCTCC 2 cut(s) 78, 108
Bsc4I CCNNNNNNNGG 1 cut(s) 22
Bse118I RCCGGY 1 cut(s) 47
BseDI CCNNGG 1 cut(s) 160
BseLI CCNNNNNNNGG 1 cut(s) 22
BseRI GAGGAG 2 cut(s) 102, 106
BseX3I CGGCCG 1 cut(s) 72
Bsh1285I CGRYCG 1 cut(s) 75
BshFI GGCC 2 cut(s) 74, 151
BsiEI CGRYCG 1 cut(s) 75
BsiSI CCGG 1 cut(s) 48
BslI CCNNNNNNNGG 1 cut(s) 22
BsmAI GTCTC 1 cut(s) 161
BsnI GGCC 2 cut(s) 74, 151
Bso31I GGTCTC 1 cut(s) 161
Bsp1286I GDGCHC 1 cut(s) 15
Bsp143I GATC 1 cut(s) 111
BspACI CCGC 1 cut(s) 84
BspANI GGCC 2 cut(s) 74, 151
BspLI GGNNCC 1 cut(s) 14
BspTNI GGTCTC 1 cut(s) 161
BsrBI CCGCTC 1 cut(s) 84
BsrFI RCCGGY 1 cut(s) 47
BssAI RCCGGY 1 cut(s) 47
BssECI CCNNGG 1 cut(s) 160
BssMI GATC 1 cut(s) 111
BssNI GRCGYC 2 cut(s) 33, 45
BstACI GRCGYC 2 cut(s) 33, 45
BstDSI CCRYGG 1 cut(s) 160
BstH2I RGCGCY 1 cut(s) 134
BstHHI GCGC 1 cut(s) 133
BstKTI GATC 1 cut(s) 114
BstMAI GTCTC 1 cut(s) 161
BstMBI GATC 1 cut(s) 111
BstMCI CGRYCG 1 cut(s) 75
BstX2I RGATCY 1 cut(s) 111
BstYI RGATCY 1 cut(s) 111
BstZI CGGCCG 1 cut(s) 72
BsuRI GGCC 2 cut(s) 74, 151
BtgI CCRYGG 1 cut(s) 160
CfoI GCGC 1 cut(s) 133
Cfr10I RCCGGY 1 cut(s) 47
Cfr13I GGNCC 1 cut(s) 122
CseI GACGC 1 cut(s) 53
CviJI RGCY 4 cut(s) 5, 13, 74, 151
CviKI_1 RGCY 4 cut(s) 5, 13, 74, 151
DpnI GATC 1 cut(s) 113
DpnII GATC 1 cut(s) 111
EaeI YGGCCR 1 cut(s) 72
EagI CGGCCG 1 cut(s) 72
EclXI CGGCCG 1 cut(s) 72
Eco24I GRGCYC 1 cut(s) 15
Eco31I GGTCTC 1 cut(s) 161
Eco47I GGWCC 1 cut(s) 122
Eco52I CGGCCG 1 cut(s) 72
EcoT38I GRGCYC 1 cut(s) 15
FalI AAGNNNNNCTT 2 cut(s) 130, 162
FriOI GRGCYC 1 cut(s) 15
FspBI CTAG 2 cut(s) 134, 172
GlaI GCGC 1 cut(s) 132
HaeII RGCGCY 1 cut(s) 134
HaeIII GGCC 2 cut(s) 74, 151
HapII CCGG 1 cut(s) 48
HgaI GACGC 1 cut(s) 53
HhaI GCGC 1 cut(s) 133
Hin1I GRCGYC 2 cut(s) 33, 45
Hin6I GCGC 1 cut(s) 131
HinP1I GCGC 1 cut(s) 131
HpaII CCGG 1 cut(s) 48
Hpy188III TCNNGA 1 cut(s) 41
Hpy99I CGWCG 2 cut(s) 35, 38
HpyCH4IV ACGT 2 cut(s) 19, 33
HpySE526I ACGT 2 cut(s) 19, 33
Hsp92I GRCGYC 2 cut(s) 33, 45
HspAI GCGC 1 cut(s) 131
Kzo9I GATC 1 cut(s) 111
LmnI GCTCC 1 cut(s) 18
LpnPI CCDG 3 cut(s) 61, 80, 105
MaeI CTAG 2 cut(s) 134, 172
MaeII ACGT 2 cut(s) 19, 33
MalI GATC 1 cut(s) 113
MbiI CCGCTC 1 cut(s) 84
MboI GATC 1 cut(s) 111
MflI RGATCY 1 cut(s) 111
MhlI GDGCHC 1 cut(s) 15
MmeI TCCRAC 1 cut(s) 149
MnlI CCTC 4 cut(s) 80, 91, 97, 127
MspI CCGG 1 cut(s) 48
NdeII GATC 1 cut(s) 111
NlaIV GGNNCC 1 cut(s) 14
PspN4I GGNNCC 1 cut(s) 14
PspPI GGNCC 1 cut(s) 122
PsuI RGATCY 1 cut(s) 111
Sau3AI GATC 1 cut(s) 111
Sau96I GGNCC 1 cut(s) 122
SduI GDGCHC 1 cut(s) 15
SetI ASST 4 cut(s) 22, 36, 102, 173
SgeI CNNG 9 cut(s) 22, 53, 60, 79, 115, 132, 146, 159, 165
SgrAI CRCCGGYG 1 cut(s) 47
SinI GGWCC 1 cut(s) 122
SsiI CCGC 1 cut(s) 84
SspMI CTAG 2 cut(s) 134, 172
TaiI ACGT 2 cut(s) 22, 36
TaqI TCGA 1 cut(s) 102
VpaK11BI GGWCC 1 cut(s) 122
XspI CTAG 2 cut(s) 134, 172
ZraI GACGTC 1 cut(s) 34
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.