Rh7CG322400

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
OG0017869
Physical Location & Seq
Forward (+)
35051854 .. 35063021
11168 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG322400.1

Sequence Viewer

Length: 210 bp
ATGGTTGTCGTGCTCCTACGCTGGGCAAACGACGTCGTTCAAGACGCCAGTGTGGAGAAACTCAACCAGACGGCCGAAGTGGGCGGAGGAGATGTTGAGGTCGAGGGAGAGATCTCCTCTGGTCCAACGATGCCAGGAAGTAGTGAAGGCAAACCCTTTGGTCAGTTTTTGGATATGGGTTATTGTGTGTGGTCTGAAATTGAGCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.39

Weight (kDa)

4.05

Isoelectric Point (pI)

47.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 36
AciI CCGC 1 cut(s) 84
AcoI YGGCCR 1 cut(s) 72
AcyI GRCGYC 2 cut(s) 33, 45
AfiI CCNNNNNNNGG 1 cut(s) 22
AgsI TTSAA 1 cut(s) 41
AjnI CCWGG 1 cut(s) 133
AluBI AGCT 1 cut(s) 205
AluI AGCT 1 cut(s) 205
Alw21I GWGCWC 1 cut(s) 15
AoxI GGCC 1 cut(s) 72
AspS9I GGNCC 1 cut(s) 122
AvaII GGWCC 1 cut(s) 122
Bbv12I GWGCWC 1 cut(s) 15
BceAI ACGGC 1 cut(s) 87
BciT130I CCWGG 1 cut(s) 135
BglII AGATCT 1 cut(s) 111
Bme1390I CCNGG 1 cut(s) 135
Bme18I GGWCC 1 cut(s) 122
BmgT120I GGNCC 1 cut(s) 122
BmrFI CCNGG 1 cut(s) 135
BmsI GCATC 1 cut(s) 120
BplI GAGNNNNNCTC 2 cut(s) 101, 133
BsaHI GRCGYC 2 cut(s) 33, 45
BsaXI ACNNNNNCTCC 2 cut(s) 78, 108
Bsc4I CCNNNNNNNGG 1 cut(s) 22
Bse1I ACTGG 1 cut(s) 48
BseBI CCWGG 1 cut(s) 135
BseLI CCNNNNNNNGG 1 cut(s) 22
BseNI ACTGG 1 cut(s) 48
BseRI GAGGAG 2 cut(s) 102, 106
BseX3I CGGCCG 1 cut(s) 72
BseYI CCCAGC 1 cut(s) 21
Bsh1285I CGRYCG 1 cut(s) 75
BshFI GGCC 1 cut(s) 74
BsiEI CGRYCG 1 cut(s) 75
BsiHKAI GWGCWC 1 cut(s) 15
BslI CCNNNNNNNGG 1 cut(s) 22
BsnI GGCC 1 cut(s) 74
Bsp1286I GDGCHC 1 cut(s) 15
Bsp143I GATC 1 cut(s) 111
BspACI CCGC 1 cut(s) 84
BspANI GGCC 1 cut(s) 74
BsrI ACTGG 1 cut(s) 48
BssMI GATC 1 cut(s) 111
BssNI GRCGYC 2 cut(s) 33, 45
Bst2UI CCWGG 1 cut(s) 135
BstACI GRCGYC 2 cut(s) 33, 45
BstKTI GATC 1 cut(s) 114
BstMBI GATC 1 cut(s) 111
BstMCI CGRYCG 1 cut(s) 75
BstNI CCWGG 1 cut(s) 135
BstSCI CCNGG 1 cut(s) 133
BstX2I RGATCY 1 cut(s) 111
BstYI RGATCY 1 cut(s) 111
BstZI CGGCCG 1 cut(s) 72
BsuRI GGCC 1 cut(s) 74
BtsIMutI CAGTG 1 cut(s) 55
Cfr13I GGNCC 1 cut(s) 122
CseI GACGC 1 cut(s) 53
CviJI RGCY 2 cut(s) 74, 205
CviKI_1 RGCY 2 cut(s) 74, 205
DpnI GATC 1 cut(s) 113
DpnII GATC 1 cut(s) 111
EaeI YGGCCR 1 cut(s) 72
EagI CGGCCG 1 cut(s) 72
EciI GGCGGA 1 cut(s) 99
EclXI CGGCCG 1 cut(s) 72
Eco47I GGWCC 1 cut(s) 122
Eco52I CGGCCG 1 cut(s) 72
EcoRII CCWGG 1 cut(s) 133
FaiI YATR 1 cut(s) 176
GsaI CCCAGC 1 cut(s) 25
HaeIII GGCC 1 cut(s) 74
HgaI GACGC 1 cut(s) 53
Hin1I GRCGYC 2 cut(s) 33, 45
Hpy188I TCNGA 1 cut(s) 196
Hpy188III TCNNGA 1 cut(s) 41
Hpy99I CGWCG 2 cut(s) 35, 38
HpyAV CCTTC 1 cut(s) 140
HpyCH4IV ACGT 1 cut(s) 33
HpySE526I ACGT 1 cut(s) 33
Hsp92I GRCGYC 2 cut(s) 33, 45
Kzo9I GATC 1 cut(s) 111
LmnI GCTCC 1 cut(s) 18
LpnPI CCDG 6 cut(s) 7, 61, 80, 105, 120, 147
LweI GCATC 1 cut(s) 120
MaeII ACGT 1 cut(s) 33
MalI GATC 1 cut(s) 113
MboI GATC 1 cut(s) 111
MflI RGATCY 1 cut(s) 111
MhlI GDGCHC 1 cut(s) 15
MluCI AATT 1 cut(s) 198
MmeI TCCRAC 1 cut(s) 149
MnlI CCTC 4 cut(s) 80, 91, 97, 127
MseI TTAA 1 cut(s) 208
MspR9I CCNGG 1 cut(s) 135
MvaI CCWGG 1 cut(s) 135
NdeII GATC 1 cut(s) 111
Psp6I CCWGG 1 cut(s) 133
PspFI CCCAGC 1 cut(s) 21
PspGI CCWGG 1 cut(s) 133
PspPI GGNCC 1 cut(s) 122
PsuI RGATCY 1 cut(s) 111
SaqAI TTAA 1 cut(s) 208
Sau3AI GATC 1 cut(s) 111
Sau96I GGNCC 1 cut(s) 122
ScrFI CCNGG 1 cut(s) 135
SduI GDGCHC 1 cut(s) 15
SetI ASST 3 cut(s) 36, 102, 207
SfaNI GCATC 1 cut(s) 120
SgeI CNNG 9 cut(s) 22, 34, 53, 60, 79, 115, 132, 146, 147
SinI GGWCC 1 cut(s) 122
Sse9I AATT 1 cut(s) 198
SsiI CCGC 1 cut(s) 84
StyD4I CCNGG 1 cut(s) 133
TaiI ACGT 1 cut(s) 36
TaqI TCGA 1 cut(s) 102
TasI AATT 1 cut(s) 198
Tru1I TTAA 1 cut(s) 208
Tru9I TTAA 1 cut(s) 208
TscAI CASTG 1 cut(s) 55
TspRI CASTG 1 cut(s) 55
VpaK11BI GGWCC 1 cut(s) 122
ZraI GACGTC 1 cut(s) 34
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.