Rh5DG205000

Glucan endo-1,3-beta-glucosidase-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
22718688 .. 22720355
1668 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG205000.1

Sequence Viewer

Length: 285 bp
ATGGTAAATGGGCAGAAAACTTGGTGTGTGGCCAAACCTTCAACAGACCAAGCGACCCTTTTAGCAAATCTGAATTTCGCATGCTCTCACGTAGATTGTCGGATTCTTCAAGGTGGATGTCCATGCTCCTCTCCGGATAATCTCATGAATCATGCCTCTATAGCCATGAATCTATACTACCAAGCTAAGGGAAGGAACCAGTGGAACTGTGATTTTAGGTGCTCTGGTCTTATTGTCATGACTAATCCAAGTAAGTCACATTTTACAGCAAGCCAATTACTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

94

Amino Acids

10.34

Weight (kDa)

8.55

Isoelectric Point (pI)

25.67

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
X8 PF07983 7 - 74 2e-18 X8 domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012725)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G78520 AT2G43670
fragaria_vesca FvH4_3g17340
malus_domestica MD11G1273700.v1.1
prunus_persica Prupe.4G153400_v2.0.a1
pyrus_communis pycom11g24140
rosa_chinensis RchiOBHm_Chr5g0028861
rosa_laevigata RLG00000033120
rosa_multiflora Rmu_sc0005178.1_g000012
rosa_roxburghii Rroxscaffold_1G00051020
rosa_rugosa Rorug05G0110800 Rorug05G0110900 Rorug05G0111000
rosa_samantha Rh5AG203300 Rh5BG201400 Rh5CG222400 Rh5DG205000
rosa_wichuraiana Rw5G018390

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 133
AcoI YGGCCR 1 cut(s) 30
AcsI RAATTY 1 cut(s) 73
AfiI CCNNNNNNNGG 1 cut(s) 187
AgsI TTSAA 2 cut(s) 42, 110
AluBI AGCT 1 cut(s) 185
AluI AGCT 1 cut(s) 185
Alw21I GWGCWC 1 cut(s) 224
Aor13HI TCCGGA 1 cut(s) 133
AoxI GGCC 1 cut(s) 30
ApoI RAATTY 1 cut(s) 73
BalI TGGCCA 1 cut(s) 32
Bbv12I GWGCWC 1 cut(s) 224
BfmI CTRYAG 1 cut(s) 159
BmiI GGNNCC 1 cut(s) 197
Bpu10I CCTNAGC 1 cut(s) 186
BsaAI YACGTR 1 cut(s) 91
BsaWI WCCGGW 1 cut(s) 133
Bsc4I CCNNNNNNNGG 1 cut(s) 187
Bse1I ACTGG 1 cut(s) 199
BseAI TCCGGA 1 cut(s) 133
BseGI GGATG 1 cut(s) 122
BseLI CCNNNNNNNGG 1 cut(s) 187
BseNI ACTGG 1 cut(s) 199
BseRI GAGGAG 1 cut(s) 118
BshFI GGCC 1 cut(s) 32
BsiHKAI GWGCWC 1 cut(s) 224
BsiSI CCGG 1 cut(s) 134
BslI CCNNNNNNNGG 1 cut(s) 187
BsnI GGCC 1 cut(s) 32
Bsp1286I GDGCHC 1 cut(s) 224
Bsp13I TCCGGA 1 cut(s) 133
BspANI GGCC 1 cut(s) 32
BspEI TCCGGA 1 cut(s) 133
BspHI TCATGA 2 cut(s) 144, 237
BspLI GGNNCC 1 cut(s) 197
BsrI ACTGG 1 cut(s) 199
Bst4CI ACNGT 1 cut(s) 209
BstBAI YACGTR 1 cut(s) 91
BstC8I GCNNGC 2 cut(s) 82, 271
BstDEI CTNAG 1 cut(s) 186
BstF5I GGATG 1 cut(s) 122
BstMWI GCNNNNNNNGC 1 cut(s) 161
BstNSI RCATGY 1 cut(s) 84
BstSFI CTRYAG 1 cut(s) 159
BsuRI GGCC 1 cut(s) 32
BtsCI GGATG 1 cut(s) 122
BtsIMutI CAGTG 1 cut(s) 206
Cac8I GCNNGC 2 cut(s) 82, 271
CciI TCATGA 2 cut(s) 144, 237
CviAII CATG 6 cut(s) 81, 123, 145, 152, 166, 238
CviJI RGCY 4 cut(s) 32, 164, 185, 273
CviKI_1 RGCY 4 cut(s) 32, 164, 185, 273
DdeI CTNAG 1 cut(s) 186
EaeI YGGCCR 1 cut(s) 30
FaeI CATG 6 cut(s) 84, 126, 148, 155, 169, 241
FaiI YATR 9 cut(s) 82, 124, 146, 153, 161, 167, 175, 239, 283
FalI AAGNNNNNCTT 2 cut(s) 42, 74
FatI CATG 6 cut(s) 80, 122, 144, 151, 165, 237
FokI GGATG 1 cut(s) 129
HaeIII GGCC 1 cut(s) 32
HapII CCGG 1 cut(s) 134
Hin1II CATG 6 cut(s) 84, 126, 148, 155, 169, 241
HinfI GANTC 3 cut(s) 103, 148, 169
HpaII CCGG 1 cut(s) 134
Hpy188I TCNGA 2 cut(s) 72, 102
Hpy188III TCNNGA 3 cut(s) 134, 145, 238
HpyAV CCTTC 2 cut(s) 48, 186
HpyCH4III ACNGT 1 cut(s) 209
HpyCH4IV ACGT 1 cut(s) 90
HpyF10VI GCNNNNNNNGC 1 cut(s) 161
HpyF3I CTNAG 1 cut(s) 186
HpySE526I ACGT 1 cut(s) 90
Hsp92II CATG 6 cut(s) 84, 126, 148, 155, 169, 241
Kpn2I TCCGGA 1 cut(s) 133
LmnI GCTCC 1 cut(s) 131
LpnPI CCDG 3 cut(s) 147, 210, 212
MaeII ACGT 1 cut(s) 90
MaeIII GTNAC 1 cut(s) 255
MboII GAAGA 1 cut(s) 98
MhlI GDGCHC 1 cut(s) 224
MlsI TGGCCA 1 cut(s) 32
MluCI AATT 2 cut(s) 73, 275
MluNI TGGCCA 1 cut(s) 32
MmeI TCCRAC 1 cut(s) 80
MnlI CCTC 2 cut(s) 139, 166
Mox20I TGGCCA 1 cut(s) 32
MroI TCCGGA 1 cut(s) 133
MscI TGGCCA 1 cut(s) 32
Msp20I TGGCCA 1 cut(s) 32
MspI CCGG 1 cut(s) 134
MwoI GCNNNNNNNGC 1 cut(s) 161
NlaIII CATG 6 cut(s) 84, 126, 148, 155, 169, 241
NlaIV GGNNCC 1 cut(s) 197
NmuCI GTSAC 1 cut(s) 255
NspI RCATGY 1 cut(s) 84
PaeI GCATGC 1 cut(s) 84
PagI TCATGA 2 cut(s) 144, 237
PfeI GAWTC 3 cut(s) 103, 148, 169
Ppu21I YACGTR 1 cut(s) 91
PspN4I GGNNCC 1 cut(s) 197
SduI GDGCHC 1 cut(s) 224
SetI ASST 5 cut(s) 40, 93, 115, 187, 221
SfcI CTRYAG 1 cut(s) 159
SphI GCATGC 1 cut(s) 84
Sse9I AATT 2 cut(s) 73, 275
TaaI ACNGT 1 cut(s) 209
TaiI ACGT 1 cut(s) 93
TasI AATT 2 cut(s) 73, 275
TfiI GAWTC 3 cut(s) 103, 148, 169
TscAI CASTG 1 cut(s) 206
TseFI GTSAC 1 cut(s) 255
Tsp45I GTSAC 1 cut(s) 255
TspDTI ATGAA 2 cut(s) 161, 182
TspRI CASTG 1 cut(s) 206
XapI RAATTY 1 cut(s) 73
XceI RCATGY 1 cut(s) 84
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.