Rh6BG391300

WD repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
OG0012579
Physical Location & Seq
Reverse (-)
61918844 .. 61919556
713 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG391300.1

Sequence Viewer

Length: 315 bp
ATGGCTGACGACGCTCACAAACGTCAGAGGCTGGAAAAAGAAACGGGCTATTTCTTCAACCTGGCTTATTTTGAACACTGCTTTGTGCGGGGATATTTCGAAGAGGCTGAGAACTACCTCGCTGGCTTTCTTCCAAGTATCCCTGGTAATGTCTACTCCGTTAATGTTTACTTCGAGTTAAACTGGCAAAAGTTTCTGGTGGTGCTTGATGAGAACGACCATACTGAGGTGCAAATAATCATTGACGAAGATCTCAGACCCTTTGAGCGGTACCACCCCAATCTGGTTGTTTCTGCAAGCGAGTTAGCGAGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04137 ko04140 map04137 map04140
Pfam Domains
Protein Families
WD40

Protein Analysis

104

Amino Acids

12.27

Weight (kDa)

4.62

Isoelectric Point (pI)

26.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TPR1-like_2nd PF21889 20 - 99 1.3e-14 TPR1-like, CTLH-containing domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 270
AccB1I GGYRCC 1 cut(s) 270
AccBSI CCGCTC 1 cut(s) 268
AccI GTMKAC 1 cut(s) 153
AciI CCGC 2 cut(s) 88, 268
AfaI GTAC 1 cut(s) 272
AfiI CCNNNNNNNGG 3 cut(s) 226, 267, 283
AgsI TTSAA 2 cut(s) 58, 74
AjnI CCWGG 2 cut(s) 60, 142
AlwNI CAGNNNCTG 1 cut(s) 31
Asp718I GGTACC 1 cut(s) 270
AsuII TTCGAA 1 cut(s) 99
BanI GGYRCC 1 cut(s) 270
BciT130I CCWGG 2 cut(s) 62, 144
BciVI GTATCC 1 cut(s) 149
BfuI GTATCC 1 cut(s) 149
BglII AGATCT 1 cut(s) 250
Bme1390I CCNGG 2 cut(s) 62, 144
BmiI GGNNCC 1 cut(s) 272
BmrFI CCNGG 2 cut(s) 62, 144
Bpu14I TTCGAA 1 cut(s) 99
BsaJI CCNNGG 1 cut(s) 142
Bsc4I CCNNNNNNNGG 3 cut(s) 226, 267, 283
Bse1I ACTGG 1 cut(s) 188
BseBI CCWGG 2 cut(s) 62, 144
BseDI CCNNGG 1 cut(s) 142
BseLI CCNNNNNNNGG 3 cut(s) 226, 267, 283
BseMII CTCAG 3 cut(s) 99, 216, 268
BseNI ACTGG 1 cut(s) 188
BshNI GGYRCC 1 cut(s) 270
BslI CCNNNNNNNGG 3 cut(s) 226, 267, 283
Bsp119I TTCGAA 1 cut(s) 99
Bsp143I GATC 1 cut(s) 250
BspACI CCGC 2 cut(s) 88, 268
BspCNI CTCAG 3 cut(s) 100, 217, 267
BspLI GGNNCC 1 cut(s) 272
BspT104I TTCGAA 1 cut(s) 99
BspT107I GGYRCC 1 cut(s) 270
BsrBI CCGCTC 1 cut(s) 268
BsrI ACTGG 1 cut(s) 188
BssECI CCNNGG 1 cut(s) 142
BssMI GATC 1 cut(s) 250
Bst2UI CCWGG 2 cut(s) 62, 144
Bst6I CTCTTC 1 cut(s) 96
BstBI TTCGAA 1 cut(s) 99
BstC8I GCNNGC 2 cut(s) 124, 298
BstDEI CTNAG 3 cut(s) 108, 225, 254
BstKTI GATC 1 cut(s) 253
BstMBI GATC 1 cut(s) 250
BstMWI GCNNNNNNNGC 1 cut(s) 11
BstNI CCWGG 2 cut(s) 62, 144
BstSCI CCNGG 2 cut(s) 60, 142
BstX2I RGATCY 1 cut(s) 250
BstYI RGATCY 1 cut(s) 250
BsuI GTATCC 1 cut(s) 149
BtsI GCAGTG 1 cut(s) 76
BtsIMutI CAGTG 1 cut(s) 76
Cac8I GCNNGC 2 cut(s) 124, 298
CaiI CAGNNNCTG 1 cut(s) 31
CseI GACGC 1 cut(s) 20
Csp6I GTAC 1 cut(s) 271
CviJI RGCY 6 cut(s) 5, 31, 48, 65, 107, 126
CviKI_1 RGCY 6 cut(s) 5, 31, 48, 65, 107, 126
CviQI GTAC 1 cut(s) 271
DdeI CTNAG 3 cut(s) 108, 225, 254
DpnI GATC 1 cut(s) 252
DpnII GATC 1 cut(s) 250
Eam1104I CTCTTC 1 cut(s) 96
EarI CTCTTC 1 cut(s) 96
EcoRII CCWGG 2 cut(s) 60, 142
FaiI YATR 1 cut(s) 222
FauI CCCGC 1 cut(s) 81
FblI GTMKAC 1 cut(s) 153
HgaI GACGC 1 cut(s) 20
Hpy166II GTNNAC 2 cut(s) 154, 169
Hpy188I TCNGA 2 cut(s) 27, 257
Hpy8I GTNNAC 2 cut(s) 154, 169
Hpy99I CGWCG 1 cut(s) 14
HpyCH4IV ACGT 1 cut(s) 22
HpyCH4V TGCA 2 cut(s) 232, 296
HpyF10VI GCNNNNNNNGC 1 cut(s) 11
HpyF3I CTNAG 3 cut(s) 108, 225, 254
HpySE526I ACGT 1 cut(s) 22
KpnI GGTACC 1 cut(s) 274
Kzo9I GATC 1 cut(s) 250
LpnPI CCDG 9 cut(s) 17, 47, 74, 108, 129, 156, 169, 182, 269
MaeII ACGT 1 cut(s) 22
MalI GATC 1 cut(s) 252
MbiI CCGCTC 1 cut(s) 268
MboI GATC 1 cut(s) 250
MboII GAAGA 4 cut(s) 46, 113, 122, 260
MflI RGATCY 1 cut(s) 250
MnlI CCTC 4 cut(s) 21, 97, 128, 220
MseI TTAA 2 cut(s) 162, 179
MspR9I CCNGG 2 cut(s) 62, 144
MvaI CCWGG 2 cut(s) 62, 144
MwoI GCNNNNNNNGC 1 cut(s) 11
NdeII GATC 1 cut(s) 250
NlaIV GGNNCC 1 cut(s) 272
NspV TTCGAA 1 cut(s) 99
Psp6I CCWGG 2 cut(s) 60, 142
PspGI CCWGG 2 cut(s) 60, 142
PspN4I GGNNCC 1 cut(s) 272
PstNI CAGNNNCTG 1 cut(s) 31
PsuI RGATCY 1 cut(s) 250
RsaI GTAC 1 cut(s) 272
RsaNI GTAC 1 cut(s) 271
SaqAI TTAA 2 cut(s) 162, 179
Sau3AI GATC 1 cut(s) 250
ScrFI CCNGG 2 cut(s) 62, 144
SetI ASST 4 cut(s) 25, 63, 120, 231
SfuI TTCGAA 1 cut(s) 99
SsiI CCGC 2 cut(s) 88, 268
StyD4I CCNGG 2 cut(s) 60, 142
TaiI ACGT 1 cut(s) 25
TaqI TCGA 2 cut(s) 99, 174
Tru1I TTAA 2 cut(s) 162, 179
Tru9I TTAA 2 cut(s) 162, 179
TscAI CASTG 1 cut(s) 83
TspGWI ACGGA 1 cut(s) 148
TspRI CASTG 1 cut(s) 83
XmiI GTMKAC 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.