Rh6CG141200

Acetylornithine deacetylase-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Reverse (-)
18282446 .. 18282625
180 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG141200.1

Sequence Viewer

Length: 180 bp
ATGGCTTCCTCCACCACCGACGACCTCAAGAAAACCCTCGGCGACCTCGACAAGGACTCCTCCATATCCCTCCTCTCTAAGCTCATCGGCGAGGCCAAATTCATCCAGAACAACCCCCCTGACCTCATTCCTCAGGAGGACCGAGTCGTCAAGCACGTGCTCGCCTCTCTTGCCCCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

59

Amino Acids

6.38

Weight (kDa)

5.03

Isoelectric Point (pI)

28.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 146
AcsI RAATTY 1 cut(s) 98
AcvI CACGTG 1 cut(s) 157
AfiI CCNNNNNNNGG 1 cut(s) 52
AluBI AGCT 1 cut(s) 82
AluI AGCT 1 cut(s) 82
Alw21I GWGCWC 1 cut(s) 162
AoxI GGCC 1 cut(s) 93
ApoI RAATTY 1 cut(s) 98
AspS9I GGNCC 1 cut(s) 139
AvaII GGWCC 1 cut(s) 139
AxyI CCTNAGG 1 cut(s) 132
BbrPI CACGTG 1 cut(s) 157
Bbv12I GWGCWC 1 cut(s) 162
Bme18I GGWCC 1 cut(s) 139
BmgT120I GGNCC 1 cut(s) 139
BpuEI CTTGAG 1 cut(s) 11
BsaAI YACGTR 1 cut(s) 157
BsaJI CCNNGG 1 cut(s) 37
BsaXI ACNNNNNCTCC 2 cut(s) 41, 71
Bsc4I CCNNNNNNNGG 1 cut(s) 52
Bse21I CCTNAGG 1 cut(s) 132
BseDI CCNNGG 1 cut(s) 37
BseGI GGATG 1 cut(s) 102
BseLI CCNNNNNNNGG 1 cut(s) 52
BseMII CTCAG 1 cut(s) 146
BseRI GAGGAG 2 cut(s) 49, 62
BshFI GGCC 1 cut(s) 95
BsiHKAI GWGCWC 1 cut(s) 162
BslI CCNNNNNNNGG 1 cut(s) 52
BsnI GGCC 1 cut(s) 95
Bsp1286I GDGCHC 1 cut(s) 162
BspANI GGCC 1 cut(s) 95
BspCNI CTCAG 1 cut(s) 145
BssECI CCNNGG 1 cut(s) 37
BstBAI YACGTR 1 cut(s) 157
BstC8I GCNNGC 1 cut(s) 162
BstDEI CTNAG 3 cut(s) 78, 132, 177
BstENI CCTNNNNNAGG 1 cut(s) 50
BstF5I GGATG 1 cut(s) 102
BstMWI GCNNNNNNNGC 1 cut(s) 170
Bsu36I CCTNAGG 1 cut(s) 132
BsuRI GGCC 1 cut(s) 95
BtsCI GGATG 1 cut(s) 102
Cac8I GCNNGC 1 cut(s) 162
Cfr13I GGNCC 1 cut(s) 139
CviJI RGCY 3 cut(s) 5, 82, 95
CviKI_1 RGCY 3 cut(s) 5, 82, 95
DdeI CTNAG 3 cut(s) 78, 132, 177
DrdI GACNNNNNNGTC 1 cut(s) 146
DseDI GACNNNNNNGTC 1 cut(s) 146
Eco47I GGWCC 1 cut(s) 139
Eco72I CACGTG 1 cut(s) 157
Eco81I CCTNAGG 1 cut(s) 132
EcoNI CCTNNNNNAGG 1 cut(s) 50
FaiI YATR 1 cut(s) 65
FokI GGATG 1 cut(s) 89
HaeIII GGCC 1 cut(s) 95
HinfI GANTC 2 cut(s) 56, 144
Hpy188III TCNNGA 3 cut(s) 28, 106, 134
Hpy99I CGWCG 1 cut(s) 23
HpyCH4IV ACGT 1 cut(s) 156
HpyF10VI GCNNNNNNNGC 1 cut(s) 170
HpyF3I CTNAG 3 cut(s) 78, 132, 177
HpySE526I ACGT 1 cut(s) 156
LpnPI CCDG 3 cut(s) 119, 119, 132
MaeII ACGT 1 cut(s) 156
MhlI GDGCHC 1 cut(s) 162
MluCI AATT 1 cut(s) 98
MlyI GAGTC 2 cut(s) 50, 153
MwoI GCNNNNNNNGC 1 cut(s) 170
NmeAIII GCCGAG 1 cut(s) 18
PcsI WCGNNNNNNNCGW 2 cut(s) 45, 153
PflFI GACNNNGTC 1 cut(s) 143
PleI GAGTC 2 cut(s) 50, 152
PmaCI CACGTG 1 cut(s) 157
PmlI CACGTG 1 cut(s) 157
PpsI GAGTC 2 cut(s) 50, 152
Ppu21I YACGTR 1 cut(s) 157
PspCI CACGTG 1 cut(s) 157
PspPI GGNCC 1 cut(s) 139
PsyI GACNNNGTC 1 cut(s) 143
Sau96I GGNCC 1 cut(s) 139
SchI GAGTC 2 cut(s) 50, 153
SduI GDGCHC 1 cut(s) 162
SetI ASST 5 cut(s) 27, 48, 84, 126, 159
SinI GGWCC 1 cut(s) 139
SmlI CTYRAG 1 cut(s) 26
SmoI CTYRAG 1 cut(s) 26
Sse9I AATT 1 cut(s) 98
TaiI ACGT 1 cut(s) 159
TaqI TCGA 1 cut(s) 48
TaqII GACCGA 1 cut(s) 156
TasI AATT 1 cut(s) 98
TspDTI ATGAA 1 cut(s) 91
Tth111I GACNNNGTC 1 cut(s) 143
VpaK11BI GGWCC 1 cut(s) 139
XagI CCTNNNNNAGG 1 cut(s) 50
XapI RAATTY 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.