Rh6CG298100

Vacuolar protein sorting-associated protein 62

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0007670
Physical Location & Seq
Reverse (-)
47894362 .. 47896282
1921 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG298100.1

Sequence Viewer

Length: 228 bp
ATGTTCTTGTGCAAGTGCTTCTATTGGAATCAACTCAAAGATTTATTTCCACCACAGCCTGAACCCTTCTCCCTGCCTGCTCCAATTCCTCAATGGCCTCCAGGTGAAGGTTTTGCTTCTGGAAAAATAAGTATTGGAGAAATAGAGGTTTCCGAGATCACCAGATTTGAACGAATCTGGGCCTGCACTCTGCCAGAGGACAAGAAAAAAAACAGTTACATTTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Vps62

Protein Analysis

75

Amino Acids

8.67

Weight (kDa)

5.29

Isoelectric Point (pI)

68.9

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Vps62 PF06101 20 - 71 1.5e-15 Vacuolar protein sorting-associated protein 62
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 226
AfiI CCNNNNNNNGG 1 cut(s) 107
AgsI TTSAA 1 cut(s) 170
AjnI CCWGG 1 cut(s) 100
AoxI GGCC 2 cut(s) 95, 180
AspS9I GGNCC 1 cut(s) 180
AsuHPI GGTGA 2 cut(s) 116, 151
BciT130I CCWGG 1 cut(s) 102
Bme1390I CCNGG 1 cut(s) 102
BmgT120I GGNCC 1 cut(s) 180
BmrFI CCNGG 1 cut(s) 102
BpmI CTGGAG 1 cut(s) 84
Bsc4I CCNNNNNNNGG 1 cut(s) 107
BseBI CCWGG 1 cut(s) 102
BseLI CCNNNNNNNGG 1 cut(s) 107
BsgI GTGCAG 1 cut(s) 169
BshFI GGCC 2 cut(s) 97, 182
BslI CCNNNNNNNGG 1 cut(s) 107
BsnI GGCC 2 cut(s) 97, 182
Bsp143I GATC 1 cut(s) 156
BspANI GGCC 2 cut(s) 97, 182
BssMI GATC 1 cut(s) 156
Bst2UI CCWGG 1 cut(s) 102
Bst4CI ACNGT 1 cut(s) 215
BstC8I GCNNGC 2 cut(s) 78, 184
BstKTI GATC 1 cut(s) 159
BstMBI GATC 1 cut(s) 156
BstNI CCWGG 1 cut(s) 102
BstSCI CCNGG 1 cut(s) 100
BsuRI GGCC 2 cut(s) 97, 182
Cac8I GCNNGC 2 cut(s) 78, 184
Cfr13I GGNCC 1 cut(s) 180
CviJI RGCY 3 cut(s) 58, 97, 182
CviKI_1 RGCY 3 cut(s) 58, 97, 182
DpnI GATC 1 cut(s) 158
DpnII GATC 1 cut(s) 156
EcoRII CCWGG 1 cut(s) 100
FaiI YATR 1 cut(s) 226
GsuI CTGGAG 1 cut(s) 84
HaeIII GGCC 2 cut(s) 97, 182
HinfI GANTC 2 cut(s) 28, 174
HphI GGTGA 2 cut(s) 116, 151
Hpy188I TCNGA 1 cut(s) 154
Hpy188III TCNNGA 1 cut(s) 120
HpyAV CCTTC 2 cut(s) 76, 101
HpyCH4III ACNGT 1 cut(s) 215
HpyCH4V TGCA 2 cut(s) 12, 186
Kzo9I GATC 1 cut(s) 156
LmnI GCTCC 1 cut(s) 85
MaeIII GTNAC 1 cut(s) 215
MalI GATC 1 cut(s) 158
MboI GATC 1 cut(s) 156
MluCI AATT 1 cut(s) 84
MnlI CCTC 4 cut(s) 99, 108, 139, 190
MspR9I CCNGG 1 cut(s) 102
MvaI CCWGG 1 cut(s) 102
NdeII GATC 1 cut(s) 156
PfeI GAWTC 2 cut(s) 28, 174
PsiI TTATAA 1 cut(s) 226
Psp6I CCWGG 1 cut(s) 100
PspGI CCWGG 1 cut(s) 100
PspPI GGNCC 1 cut(s) 180
Sau3AI GATC 1 cut(s) 156
Sau96I GGNCC 1 cut(s) 180
ScrFI CCNGG 1 cut(s) 102
SetI ASST 3 cut(s) 106, 112, 150
Sse9I AATT 1 cut(s) 84
StyD4I CCNGG 1 cut(s) 100
TaaI ACNGT 1 cut(s) 215
TasI AATT 1 cut(s) 84
TfiI GAWTC 2 cut(s) 28, 174
XcmI CCANNNNNNNNNTGG 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.