Rh6CG417700

Ethylene-responsive transcription factor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0013409
Physical Location & Seq
Reverse (-)
60137830 .. 60139750
1921 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG417700.1

Sequence Viewer

Length: 621 bp
ATGGCAAGACCCCAGCAACGATACCGAGGCGTACGACAAAGGCATTGGGGCTCTTGGGTCTCTGAGATTCGCCACCCTTTACTAAAGACTAGAATTTGGTTGGGAACATTTGAGACGGCTGAAGACGCAGCCAGGGCTTATGATGAAGCTGCCAGGCTTATGTGTGGACCTAGAGCCAGGACCAACTTCCCTTACAACCCAAATGCGTCTCAGTCCTCTGCCTCAAAGCTTCTCTCCCAAACTTTGACGGCTAAACTCCACAGGTGCTACATGGCTTCACTCCAAATGACCAAATCAACCCCACTCAAGCAGCCCAGCAAGCCCCAGCTGTCCTATGTTGACACAAAAAATGTTGGCATTGCTGAGAATGAGAAACCCAGCATTGAAGTGCCAGAGAAGAAACCAGCACTAACAGCTGAGCCTAAACAAGAACAAGAGCAAGAGCCAAATTGGGGATTTGTGAATAAAGTCAAAGTGGAGAGCACCCAAGATGAAGAATCCATAGAGCCTCTTGAAGATGACCACATTGAGCAGATGATTGAGGAGTTGCTCCATTATGGGTCCATTGAGCTATGCTCTGTTGTCACACCACCACAACCACCTCAGGCCTCTCTAATTTAA

Protein Analysis

206

Amino Acids

23.41

Weight (kDa)

6.24

Isoelectric Point (pI)

62.82

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AP2 PF00847 7 - 56 2.1e-12 AP2 domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013409)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G25190
fragaria_vesca FvH4_2g40810
malus_domestica MD08G1060000.v1.1 MD15G1036500.v1.1
prunus_persica Prupe.1G390800_v2.0.a1
pyrus_communis pycom08g05000 pycom15g03390
rosa_chinensis RchiOBHm_Chr6g0299771
rosa_laevigata RLG00000011390
rosa_multiflora Rmu_co8448481.1_g000001 Rmu_sc0002895.1_g000027
rosa_roxburghii Rroxscaffold_7G00168390
rosa_rugosa Rorug06G0292100
rosa_samantha Rh6AG403100 Rh6BG411600 Rh6CG417700 Rh6DG404500
rosa_wichuraiana Rw6G035280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 93
AcuI CTGAAG 1 cut(s) 141
AfaI GTAC 1 cut(s) 33
AfiI CCNNNNNNNGG 1 cut(s) 452
AgsI TTSAA 2 cut(s) 386, 515
AjnI CCWGG 3 cut(s) 131, 152, 176
AluBI AGCT 5 cut(s) 149, 229, 328, 416, 571
AluI AGCT 5 cut(s) 149, 229, 328, 416, 571
Alw21I GWGCWC 1 cut(s) 485
Alw26I GTCTC 3 cut(s) 64, 107, 213
AoxI GGCC 1 cut(s) 606
ApeKI GCWGC 3 cut(s) 128, 149, 310
ApoI RAATTY 1 cut(s) 93
AspS9I GGNCC 3 cut(s) 167, 180, 561
AvaII GGWCC 3 cut(s) 167, 180, 561
AxyI CCTNAGG 1 cut(s) 603
BanII GRGCYC 1 cut(s) 53
BbsI GAAGAC 1 cut(s) 129
Bbv12I GWGCWC 1 cut(s) 485
BbvI GCAGC 3 cut(s) 136, 140, 322
BceAI ACGGC 2 cut(s) 132, 264
BciT130I CCWGG 3 cut(s) 133, 154, 178
BcoDI GTCTC 3 cut(s) 64, 107, 213
BfaI CTAG 2 cut(s) 90, 171
BisI GCNGC 3 cut(s) 129, 150, 311
BlpI GCTNAGC 1 cut(s) 417
BlsI GCNGC 3 cut(s) 130, 151, 312
Bme1390I CCNGG 3 cut(s) 133, 154, 178
Bme18I GGWCC 3 cut(s) 167, 180, 561
BmgT120I GGNCC 3 cut(s) 167, 180, 561
BmiI GGNNCC 1 cut(s) 562
BmrFI CCNGG 3 cut(s) 133, 154, 178
BpiI GAAGAC 1 cut(s) 129
BplI GAGNNNNNCTC 2 cut(s) 560, 592
Bpu1102I GCTNAGC 1 cut(s) 417
BpuEI CTTGAG 1 cut(s) 290
BsaI GGTCTC 1 cut(s) 64
BsaJI CCNNGG 2 cut(s) 25, 132
Bsc4I CCNNNNNNNGG 1 cut(s) 452
Bse21I CCTNAGG 1 cut(s) 603
Bse3DI GCAATG 1 cut(s) 357
BseBI CCWGG 3 cut(s) 133, 154, 178
BseDI CCNNGG 2 cut(s) 25, 132
BseLI CCNNNNNNNGG 1 cut(s) 452
BseMI GCAATG 1 cut(s) 357
BseMII CTCAG 5 cut(s) 54, 224, 354, 408, 617
BseRI GAGGAG 1 cut(s) 557
BseXI GCAGC 3 cut(s) 136, 140, 322
BseYI CCCAGC 4 cut(s) 12, 314, 324, 377
BshFI GGCC 1 cut(s) 608
BsiHKAI GWGCWC 1 cut(s) 485
BsiWI CGTACG 1 cut(s) 31
BslI CCNNNNNNNGG 1 cut(s) 452
BsmAI GTCTC 3 cut(s) 64, 107, 213
BsmBI CGTCTC 2 cut(s) 107, 213
BsnI GGCC 1 cut(s) 608
Bso31I GGTCTC 1 cut(s) 64
Bsp1286I GDGCHC 2 cut(s) 53, 485
Bsp1720I GCTNAGC 1 cut(s) 417
BspANI GGCC 1 cut(s) 608
BspCNI CTCAG 5 cut(s) 55, 223, 355, 409, 616
BspLI GGNNCC 1 cut(s) 562
BspTNI GGTCTC 1 cut(s) 64
BsrDI GCAATG 1 cut(s) 357
BssECI CCNNGG 2 cut(s) 25, 132
Bst2UI CCWGG 3 cut(s) 133, 154, 178
BstC8I GCNNGC 1 cut(s) 320
BstDEI CTNAG 5 cut(s) 63, 210, 363, 417, 603
BstMAI GTCTC 3 cut(s) 64, 107, 213
BstMWI GCNNNNNNNGC 4 cut(s) 125, 134, 319, 413
BstNI CCWGG 3 cut(s) 133, 154, 178
BstSCI CCNGG 3 cut(s) 131, 152, 176
BstV1I GCAGC 3 cut(s) 136, 140, 322
BstV2I GAAGAC 1 cut(s) 129
Bsu36I CCTNAGG 1 cut(s) 603
BsuRI GGCC 1 cut(s) 608
Cac8I GCNNGC 1 cut(s) 320
Cfr13I GGNCC 3 cut(s) 167, 180, 561
CseI GACGC 2 cut(s) 134, 195
Csp6I GTAC 1 cut(s) 32
CviAII CATG 1 cut(s) 271
CviQI GTAC 1 cut(s) 32
DdeI CTNAG 5 cut(s) 63, 210, 363, 417, 603
Eco147I AGGCCT 1 cut(s) 608
Eco24I GRGCYC 1 cut(s) 53
Eco31I GGTCTC 1 cut(s) 64
Eco47I GGWCC 3 cut(s) 167, 180, 561
Eco57I CTGAAG 1 cut(s) 141
Eco81I CCTNAGG 1 cut(s) 603
EcoRII CCWGG 3 cut(s) 131, 152, 176
EcoT38I GRGCYC 1 cut(s) 53
Esp3I CGTCTC 2 cut(s) 107, 213
FaeI CATG 1 cut(s) 274
FaiI YATR 7 cut(s) 141, 161, 272, 336, 503, 558, 574
FatI CATG 1 cut(s) 270
Fnu4HI GCNGC 3 cut(s) 129, 150, 311
FriOI GRGCYC 1 cut(s) 53
Fsp4HI GCNGC 3 cut(s) 129, 150, 311
FspBI CTAG 2 cut(s) 90, 171
GluI GCNGC 3 cut(s) 129, 150, 311
GsaI CCCAGC 4 cut(s) 16, 318, 328, 381
HaeIII GGCC 1 cut(s) 608
HgaI GACGC 2 cut(s) 134, 195
Hin1II CATG 1 cut(s) 274
HincII GTYRAC 1 cut(s) 340
HindII GTYRAC 1 cut(s) 340
HindIII AAGCTT 1 cut(s) 227
HinfI GANTC 2 cut(s) 67, 497
Hpy166II GTNNAC 2 cut(s) 167, 340
Hpy188I TCNGA 1 cut(s) 64
Hpy188III TCNNGA 1 cut(s) 512
Hpy8I GTNNAC 2 cut(s) 167, 340
HpyF10VI GCNNNNNNNGC 4 cut(s) 125, 134, 319, 413
HpyF3I CTNAG 5 cut(s) 63, 210, 363, 417, 603
Hsp92II CATG 1 cut(s) 274
LmnI GCTCC 1 cut(s) 555
Lsp1109I GCAGC 3 cut(s) 136, 140, 322
MaeI CTAG 2 cut(s) 90, 171
MaeIII GTNAC 1 cut(s) 583
MboII GAAGA 4 cut(s) 134, 409, 506, 527
MhlI GDGCHC 2 cut(s) 53, 485
MluCI AATT 3 cut(s) 93, 448, 615
MnlI CCTC 7 cut(s) 20, 226, 232, 519, 535, 612, 619
MseI TTAA 1 cut(s) 619
MslI CAYNNNNRTG 1 cut(s) 386
MspA1I CMGCKG 2 cut(s) 328, 416
MspR9I CCNGG 3 cut(s) 133, 154, 178
MvaI CCWGG 3 cut(s) 133, 154, 178
MwoI GCNNNNNNNGC 4 cut(s) 125, 134, 319, 413
NlaIII CATG 1 cut(s) 274
NlaIV GGNNCC 1 cut(s) 562
NmuCI GTSAC 1 cut(s) 583
PceI AGGCCT 1 cut(s) 608
PfeI GAWTC 2 cut(s) 67, 497
Pfl23II CGTACG 1 cut(s) 31
PkrI GCNGC 3 cut(s) 130, 151, 312
Psp6I CCWGG 3 cut(s) 131, 152, 176
PspFI CCCAGC 4 cut(s) 12, 314, 324, 377
PspGI CCWGG 3 cut(s) 131, 152, 176
PspLI CGTACG 1 cut(s) 31
PspN4I GGNNCC 1 cut(s) 562
PspPI GGNCC 3 cut(s) 167, 180, 561
PvuII CAGCTG 2 cut(s) 328, 416
RsaI GTAC 1 cut(s) 33
RsaNI GTAC 1 cut(s) 32
RseI CAYNNNNRTG 1 cut(s) 386
SaqAI TTAA 1 cut(s) 619
SatI GCNGC 3 cut(s) 129, 150, 311
Sau96I GGNCC 3 cut(s) 167, 180, 561
ScrFI CCNGG 3 cut(s) 133, 154, 178
SduI GDGCHC 2 cut(s) 53, 485
SetI ASST 8 cut(s) 151, 172, 231, 266, 330, 418, 573, 604
SinI GGWCC 3 cut(s) 167, 180, 561
SmiMI CAYNNNNRTG 1 cut(s) 386
SmlI CTYRAG 1 cut(s) 305
SmoI CTYRAG 1 cut(s) 305
Sse9I AATT 3 cut(s) 93, 448, 615
SseBI AGGCCT 1 cut(s) 608
SspMI CTAG 2 cut(s) 90, 171
StuI AGGCCT 1 cut(s) 608
StyD4I CCNGG 3 cut(s) 131, 152, 176
TasI AATT 3 cut(s) 93, 448, 615
TfiI GAWTC 2 cut(s) 67, 497
Tru1I TTAA 1 cut(s) 619
Tru9I TTAA 1 cut(s) 619
TseFI GTSAC 1 cut(s) 583
TseI GCWGC 3 cut(s) 128, 149, 310
Tsp45I GTSAC 1 cut(s) 583
TspDTI ATGAA 2 cut(s) 159, 507
VpaK11BI GGWCC 3 cut(s) 167, 180, 561
XapI RAATTY 1 cut(s) 93
XspI CTAG 2 cut(s) 90, 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.