Rh6DG245400

Exostosin family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Forward (+)
43262561 .. 43263092
532 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG245400.1

Sequence Viewer

Length: 402 bp
ATGTCGACCCATTTTCTGGTTAAGTTAGATCGGACACCCTACCTCTCCGTCCTCTTCTCTTTCTGCAGCGACGACCCCGCCCCATTCTCTGATGAGCCACTCCACACGAACCTGATTTACAAACCCGAAACCTCCTTCACAGATTCATATTACCCATTCACCATGACTATTAGGGTTTACGTCTACAACATGCCCTCCAAGTTCACCTACAATTTGCTCCGCCTCTTCATCACCTCCTACAAGGACACCCCCAATCTCATCTCTAATGGAAGGCCCCGTCCACCGCCTCATCGAACAGATTTTAGCCCACTTCCACCGACAACGATCTCCAATCCAAGCCCACCTCCGCTCGACCCGACTTCAAATCCATCTCCGCCAATCCCTACTTCCAATCCGCCATAG
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

133

Amino Acids

15.09

Weight (kDa)

6.81

Isoelectric Point (pI)

48.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 16
AccBSI CCGCTC 1 cut(s) 349
AccI GTMKAC 2 cut(s) 5, 183
AciI CCGC 6 cut(s) 78, 220, 284, 347, 374, 395
AfiI CCNNNNNNNGG 1 cut(s) 16
AgsI TTSAA 1 cut(s) 363
AjuI GAANNNNNNNTTGG 2 cut(s) 370, 402
AoxI GGCC 1 cut(s) 272
ApeKI GCWGC 1 cut(s) 66
AspS9I GGNCC 1 cut(s) 273
AsuHPI GGTGA 3 cut(s) 151, 196, 223
BbvI GCAGC 1 cut(s) 78
BccI CCATC 1 cut(s) 376
BfmI CTRYAG 1 cut(s) 64
BisI GCNGC 1 cut(s) 67
BlsI GCNGC 1 cut(s) 68
BmgT120I GGNCC 1 cut(s) 273
BmiI GGNNCC 1 cut(s) 275
BsaXI ACNNNNNCTCC 2 cut(s) 179, 209
Bsc4I CCNNNNNNNGG 1 cut(s) 16
BseLI CCNNNNNNNGG 1 cut(s) 16
BseXI GCAGC 1 cut(s) 78
BshFI GGCC 1 cut(s) 274
BslI CCNNNNNNNGG 1 cut(s) 16
BsnI GGCC 1 cut(s) 274
Bsp143I GATC 2 cut(s) 28, 324
BspACI CCGC 6 cut(s) 78, 220, 284, 347, 374, 395
BspANI GGCC 1 cut(s) 274
BspLI GGNNCC 1 cut(s) 275
BspMAI CTGCAG 1 cut(s) 68
BsrBI CCGCTC 1 cut(s) 349
BssMI GATC 2 cut(s) 28, 324
Bst6I CTCTTC 2 cut(s) 59, 230
BstKTI GATC 2 cut(s) 31, 327
BstMBI GATC 2 cut(s) 28, 324
BstNSI RCATGY 1 cut(s) 193
BstSFI CTRYAG 1 cut(s) 64
BstV1I GCAGC 1 cut(s) 78
BsuRI GGCC 1 cut(s) 274
Cfr13I GGNCC 1 cut(s) 273
CviAII CATG 2 cut(s) 163, 190
CviJI RGCY 4 cut(s) 97, 274, 306, 339
CviKI_1 RGCY 4 cut(s) 97, 274, 306, 339
DpnI GATC 2 cut(s) 30, 326
DpnII GATC 2 cut(s) 28, 324
Eam1104I CTCTTC 2 cut(s) 59, 230
EarI CTCTTC 2 cut(s) 59, 230
EciI GGCGGA 3 cut(s) 209, 363, 384
EcoO109I RGGNCCY 1 cut(s) 273
FaeI CATG 2 cut(s) 166, 193
FaiI YATR 4 cut(s) 148, 164, 191, 400
FatI CATG 2 cut(s) 162, 189
FauI CCCGC 1 cut(s) 85
FblI GTMKAC 2 cut(s) 5, 183
Fnu4HI GCNGC 1 cut(s) 67
Fsp4HI GCNGC 1 cut(s) 67
GluI GCNGC 1 cut(s) 67
HaeIII GGCC 1 cut(s) 274
Hin1II CATG 2 cut(s) 166, 193
HincII GTYRAC 1 cut(s) 6
HindII GTYRAC 1 cut(s) 6
HinfI GANTC 1 cut(s) 143
HphI GGTGA 3 cut(s) 151, 196, 223
Hpy166II GTNNAC 5 cut(s) 6, 178, 184, 204, 281
Hpy188I TCNGA 2 cut(s) 33, 91
Hpy8I GTNNAC 5 cut(s) 6, 178, 184, 204, 281
Hpy99I CGWCG 1 cut(s) 74
HpyAV CCTTC 2 cut(s) 145, 264
HpyCH4IV ACGT 1 cut(s) 180
HpyCH4V TGCA 1 cut(s) 66
HpySE526I ACGT 1 cut(s) 180
Hsp92II CATG 2 cut(s) 166, 193
Kzo9I GATC 2 cut(s) 28, 324
LmnI GCTCC 1 cut(s) 222
LpnPI CCDG 2 cut(s) 2, 125
Lsp1109I GCAGC 1 cut(s) 78
MaeII ACGT 1 cut(s) 180
MalI GATC 2 cut(s) 30, 326
MbiI CCGCTC 1 cut(s) 349
MboI GATC 2 cut(s) 28, 324
MboII GAAGA 2 cut(s) 46, 217
MluCI AATT 1 cut(s) 211
MnlI CCTC 8 cut(s) 53, 62, 142, 205, 233, 244, 297, 354
MseI TTAA 1 cut(s) 21
NdeII GATC 2 cut(s) 28, 324
NlaIII CATG 2 cut(s) 166, 193
NlaIV GGNNCC 1 cut(s) 275
NspI RCATGY 1 cut(s) 193
PfeI GAWTC 1 cut(s) 143
PflMI CCANNNNNTGG 1 cut(s) 16
PkrI GCNGC 1 cut(s) 68
PspN4I GGNNCC 1 cut(s) 275
PspPI GGNCC 1 cut(s) 273
PsrI GAACNNNNNNTAC 2 cut(s) 101, 133
PstI CTGCAG 1 cut(s) 68
SalI GTCGAC 1 cut(s) 4
SaqAI TTAA 1 cut(s) 21
SatI GCNGC 1 cut(s) 67
Sau3AI GATC 2 cut(s) 28, 324
Sau96I GGNCC 1 cut(s) 273
SetI ASST 7 cut(s) 45, 114, 134, 183, 209, 236, 346
SfcI CTRYAG 1 cut(s) 64
Sse9I AATT 1 cut(s) 211
SsiI CCGC 6 cut(s) 78, 220, 284, 347, 374, 395
TaiI ACGT 1 cut(s) 183
TaqI TCGA 3 cut(s) 5, 292, 351
TasI AATT 1 cut(s) 211
TfiI GAWTC 1 cut(s) 143
Tru1I TTAA 1 cut(s) 21
Tru9I TTAA 1 cut(s) 21
TseI GCWGC 1 cut(s) 66
TspDTI ATGAA 2 cut(s) 135, 217
TspGWI ACGGA 1 cut(s) 37
Van91I CCANNNNNTGG 1 cut(s) 16
XceI RCATGY 1 cut(s) 193
XmiI GTMKAC 2 cut(s) 5, 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.