Rh6DG480400

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
OG0007489
Physical Location & Seq
Reverse (-)
64491551 .. 64491811
261 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG480400.1

Sequence Viewer

Length: 261 bp
ATGAAGACTAGTGGAGGCCCGAGTCCAGGAGGAAAGGGTCACAGCTTCACCACTTCCCAAACTCTTGAGGGGATTAAAAATGAAGGTCCGAGCTCAGGAGGAAAAGGTCATGCCTTCACAACTTCTCAGACTCTTGGAGGGATCAAAAATGGAGGTCCAAGCTCGGAAAGAAAGGTTCATGCCTTCATCAATTCTCACACTGTTCTAGGACTTGGAGAGATCAAAAAGACTGGTCCAAGCGACGGAGGCAGTGGAAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

86

Amino Acids

8.49

Weight (kDa)

9.78

Isoelectric Point (pI)

30.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 149
AfiI CCNNNNNNNGG 3 cut(s) 26, 95, 242
AhlI ACTAGT 1 cut(s) 8
AjnI CCWGG 1 cut(s) 25
AluBI AGCT 3 cut(s) 45, 93, 162
AluI AGCT 3 cut(s) 45, 93, 162
Alw21I GWGCWC 1 cut(s) 95
AlwI GGATC 1 cut(s) 149
Ama87I CYCGRG 1 cut(s) 19
AoxI GGCC 1 cut(s) 16
AspS9I GGNCC 4 cut(s) 17, 86, 155, 233
AsuHPI GGTGA 1 cut(s) 40
AvaI CYCGRG 1 cut(s) 19
AvaII GGWCC 3 cut(s) 86, 155, 233
BanII GRGCYC 1 cut(s) 95
BbsI GAAGAC 1 cut(s) 11
Bbv12I GWGCWC 1 cut(s) 95
BciT130I CCWGG 1 cut(s) 27
BcuI ACTAGT 1 cut(s) 8
BfaI CTAG 2 cut(s) 9, 206
Bme1390I CCNGG 1 cut(s) 27
Bme18I GGWCC 3 cut(s) 86, 155, 233
BmeT110I CYCGRG 1 cut(s) 19
BmgT120I GGNCC 4 cut(s) 17, 86, 155, 233
BmrFI CCNGG 1 cut(s) 27
BpiI GAAGAC 1 cut(s) 11
Bpu10I CCTNAGC 1 cut(s) 94
BpuEI CTTGAG 1 cut(s) 86
Bsc4I CCNNNNNNNGG 3 cut(s) 26, 95, 242
Bse1I ACTGG 1 cut(s) 235
BseBI CCWGG 1 cut(s) 27
BseLI CCNNNNNNNGG 3 cut(s) 26, 95, 242
BseMII CTCAG 2 cut(s) 108, 140
BseNI ACTGG 1 cut(s) 235
BshFI GGCC 1 cut(s) 18
BsiHKAI GWGCWC 1 cut(s) 95
BsiHKCI CYCGRG 1 cut(s) 19
BslI CCNNNNNNNGG 3 cut(s) 26, 95, 242
BsnI GGCC 1 cut(s) 18
BsoBI CYCGRG 1 cut(s) 19
Bsp1286I GDGCHC 1 cut(s) 95
Bsp143I GATC 2 cut(s) 141, 219
BspANI GGCC 1 cut(s) 18
BspCNI CTCAG 2 cut(s) 107, 139
BspPI GGATC 1 cut(s) 149
BsrI ACTGG 1 cut(s) 235
BssMI GATC 2 cut(s) 141, 219
Bst2UI CCWGG 1 cut(s) 27
Bst4CI ACNGT 1 cut(s) 202
BstDEI CTNAG 2 cut(s) 94, 126
BstKTI GATC 2 cut(s) 144, 222
BstMBI GATC 2 cut(s) 141, 219
BstMWI GCNNNNNNNGC 1 cut(s) 246
BstNI CCWGG 1 cut(s) 27
BstSCI CCNGG 1 cut(s) 25
BstV2I GAAGAC 1 cut(s) 11
BsuRI GGCC 1 cut(s) 18
BtsI GCAGTG 1 cut(s) 256
BtsIMutI CAGTG 2 cut(s) 198, 256
Cfr13I GGNCC 4 cut(s) 17, 86, 155, 233
CviAII CATG 2 cut(s) 110, 179
CviJI RGCY 4 cut(s) 18, 45, 93, 162
CviKI_1 RGCY 4 cut(s) 18, 45, 93, 162
DdeI CTNAG 2 cut(s) 94, 126
DpnI GATC 2 cut(s) 143, 221
DpnII GATC 2 cut(s) 141, 219
Ecl136II GAGCTC 1 cut(s) 93
Eco24I GRGCYC 1 cut(s) 95
Eco47I GGWCC 3 cut(s) 86, 155, 233
Eco53kI GAGCTC 1 cut(s) 93
Eco88I CYCGRG 1 cut(s) 19
EcoICRI GAGCTC 1 cut(s) 93
EcoRII CCWGG 1 cut(s) 25
EcoT38I GRGCYC 1 cut(s) 95
FaeI CATG 2 cut(s) 113, 182
FaiI YATR 2 cut(s) 111, 180
FatI CATG 2 cut(s) 109, 178
FriOI GRGCYC 1 cut(s) 95
FspBI CTAG 2 cut(s) 9, 206
HaeIII GGCC 1 cut(s) 18
Hin1II CATG 2 cut(s) 113, 182
HinfI GANTC 2 cut(s) 22, 130
HphI GGTGA 1 cut(s) 40
Hpy188I TCNGA 3 cut(s) 90, 129, 166
Hpy188III TCNNGA 2 cut(s) 65, 96
Hpy99I CGWCG 1 cut(s) 245
HpyAV CCTTC 3 cut(s) 77, 124, 193
HpyCH4III ACNGT 1 cut(s) 202
HpyF10VI GCNNNNNNNGC 1 cut(s) 246
HpyF3I CTNAG 2 cut(s) 94, 126
Hsp92II CATG 2 cut(s) 113, 182
Kzo9I GATC 2 cut(s) 141, 219
LpnPI CCDG 4 cut(s) 12, 39, 81, 216
MaeI CTAG 2 cut(s) 9, 206
MaeIII GTNAC 1 cut(s) 38
MalI GATC 2 cut(s) 143, 221
MboI GATC 2 cut(s) 141, 219
MboII GAAGA 1 cut(s) 16
MhlI GDGCHC 1 cut(s) 95
MluCI AATT 2 cut(s) 190, 256
MlyI GAGTC 2 cut(s) 31, 124
MnlI CCTC 7 cut(s) 8, 23, 61, 92, 131, 146, 239
MseI TTAA 1 cut(s) 75
MspR9I CCNGG 1 cut(s) 27
MvaI CCWGG 1 cut(s) 27
MwoI GCNNNNNNNGC 1 cut(s) 246
NdeII GATC 2 cut(s) 141, 219
NlaIII CATG 2 cut(s) 113, 182
NmuCI GTSAC 1 cut(s) 38
PfoI TCCNGGA 1 cut(s) 25
PleI GAGTC 2 cut(s) 30, 124
PpsI GAGTC 2 cut(s) 30, 124
Psp124BI GAGCTC 1 cut(s) 95
Psp6I CCWGG 1 cut(s) 25
PspGI CCWGG 1 cut(s) 25
PspPI GGNCC 4 cut(s) 17, 86, 155, 233
SacI GAGCTC 1 cut(s) 95
SaqAI TTAA 1 cut(s) 75
Sau3AI GATC 2 cut(s) 141, 219
Sau96I GGNCC 4 cut(s) 17, 86, 155, 233
SchI GAGTC 2 cut(s) 31, 124
ScrFI CCNGG 1 cut(s) 27
SduI GDGCHC 1 cut(s) 95
SetI ASST 7 cut(s) 47, 88, 95, 109, 157, 164, 177
SinI GGWCC 3 cut(s) 86, 155, 233
SmlI CTYRAG 1 cut(s) 65
SmoI CTYRAG 1 cut(s) 65
SpeI ACTAGT 1 cut(s) 8
Sse9I AATT 2 cut(s) 190, 256
SspMI CTAG 2 cut(s) 9, 206
SstI GAGCTC 1 cut(s) 95
StyD4I CCNGG 1 cut(s) 25
TaaI ACNGT 1 cut(s) 202
TasI AATT 2 cut(s) 190, 256
Tru1I TTAA 1 cut(s) 75
Tru9I TTAA 1 cut(s) 75
TscAI CASTG 2 cut(s) 205, 256
TseFI GTSAC 1 cut(s) 38
Tsp45I GTSAC 1 cut(s) 38
TspDTI ATGAA 4 cut(s) 17, 96, 167, 175
TspGWI ACGGA 1 cut(s) 258
TspRI CASTG 2 cut(s) 205, 256
VpaK11BI GGWCC 3 cut(s) 86, 155, 233
XspI CTAG 2 cut(s) 9, 206
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.