Rh7AG237000

Vacuolar protein sorting-associated protein 55 homolog

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Forward (+)
23187407 .. 23191779
4373 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG237000.1

Sequence Viewer

Length: 414 bp
ATGGCTGACTTACCACGCTATTTACGGCTTTGCTTTCAATCTGGGAAACTTGCTTTCTTGGCAATTTTGGTATCTGGAGGGATTGTATTGCAAATTTTGGCATGTGCTTTGTACAATAATTGGTGGCCGATGCTAACTGTAATAATGTATGTGCTTCTTCCGATGCCGTTGCTGTTCTTCGTGGGAACTGATTTGTCTGTTTTCCAGGAATCTGATAATAGCTGGGTTAATGTAACCAAGTTCATGACTGGAGCTTCAGCCATTGGAAGCATTGCAATACCAGCCATCTTAAAACACGCTGGTGTTATTGGTTGGGGAGCCCTGGCCTTGGAGCTCTCATCCTTTTTTGTATTTGTACTTGCAATAATGTGTTACATACGGTCAGATGAAGACGACAGCTACAGTTCAATCTGA

Protein Analysis

137

Amino Acids

15.08

Weight (kDa)

4.75

Isoelectric Point (pI)

35.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Vps55 PF04133 17 - 130 4e-33 Vacuolar protein sorting 55
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 125
AcsI RAATTY 1 cut(s) 93
AcuI CTGAAG 1 cut(s) 240
AfaI GTAC 2 cut(s) 113, 357
AfiI CCNNNNNNNGG 1 cut(s) 328
AgsI TTSAA 2 cut(s) 38, 408
AjnI CCWGG 2 cut(s) 204, 321
AleI CACNNNNGTG 1 cut(s) 300
AluBI AGCT 4 cut(s) 222, 254, 334, 399
AluI AGCT 4 cut(s) 222, 254, 334, 399
Alw21I GWGCWC 1 cut(s) 336
AoxI GGCC 2 cut(s) 125, 324
ApoI RAATTY 1 cut(s) 93
BanII GRGCYC 2 cut(s) 322, 336
BbsI GAAGAC 1 cut(s) 396
Bbv12I GWGCWC 1 cut(s) 336
BccI CCATC 1 cut(s) 293
BceAI ACGGC 2 cut(s) 41, 151
BcgI CGANNNNNNTGC 2 cut(s) 151, 185
BciT130I CCWGG 2 cut(s) 206, 323
BfmI CTRYAG 1 cut(s) 400
Bme1390I CCNGG 2 cut(s) 206, 323
BmiI GGNNCC 1 cut(s) 319
BmrFI CCNGG 2 cut(s) 206, 323
BmsI GCATC 2 cut(s) 120, 153
BpiI GAAGAC 1 cut(s) 396
BpmI CTGGAG 2 cut(s) 96, 270
BsaJI CCNNGG 2 cut(s) 321, 327
BsaXI ACNNNNNCTCC 2 cut(s) 69, 99
Bsc4I CCNNNNNNNGG 1 cut(s) 328
Bse1I ACTGG 1 cut(s) 253
Bse3DI GCAATG 1 cut(s) 270
BseBI CCWGG 2 cut(s) 206, 323
BseDI CCNNGG 2 cut(s) 321, 327
BseGI GGATG 1 cut(s) 338
BseLI CCNNNNNNNGG 1 cut(s) 328
BseMI GCAATG 1 cut(s) 270
BseNI ACTGG 1 cut(s) 253
BseYI CCCAGC 1 cut(s) 222
BshFI GGCC 2 cut(s) 127, 326
BsiHKAI GWGCWC 1 cut(s) 336
BslI CCNNNNNNNGG 1 cut(s) 328
BsnI GGCC 2 cut(s) 127, 326
Bsp1286I GDGCHC 2 cut(s) 322, 336
Bsp1407I TGTACA 1 cut(s) 111
BspANI GGCC 2 cut(s) 127, 326
BspHI TCATGA 1 cut(s) 243
BspLI GGNNCC 1 cut(s) 319
BsrDI GCAATG 1 cut(s) 270
BsrGI TGTACA 1 cut(s) 111
BsrI ACTGG 1 cut(s) 253
BssECI CCNNGG 2 cut(s) 321, 327
BssT1I CCWWGG 1 cut(s) 327
Bst2UI CCWGG 2 cut(s) 206, 323
Bst4CI ACNGT 3 cut(s) 139, 381, 404
BstAUI TGTACA 1 cut(s) 111
BstF5I GGATG 1 cut(s) 338
BstMWI GCNNNNNNNGC 2 cut(s) 59, 281
BstNI CCWGG 2 cut(s) 206, 323
BstNSI RCATGY 1 cut(s) 105
BstSCI CCNGG 2 cut(s) 204, 321
BstSFI CTRYAG 1 cut(s) 400
BstV2I GAAGAC 1 cut(s) 396
BsuRI GGCC 2 cut(s) 127, 326
BtsCI GGATG 1 cut(s) 338
CciI TCATGA 1 cut(s) 243
Csp6I GTAC 2 cut(s) 112, 356
CviAII CATG 2 cut(s) 102, 244
CviQI GTAC 2 cut(s) 112, 356
EaeI YGGCCR 1 cut(s) 125
Ecl136II GAGCTC 1 cut(s) 334
Eco130I CCWWGG 1 cut(s) 327
Eco24I GRGCYC 2 cut(s) 322, 336
Eco53kI GAGCTC 1 cut(s) 334
Eco57I CTGAAG 1 cut(s) 240
EcoICRI GAGCTC 1 cut(s) 334
EcoRII CCWGG 2 cut(s) 204, 321
EcoT14I CCWWGG 1 cut(s) 327
EcoT38I GRGCYC 2 cut(s) 322, 336
ErhI CCWWGG 1 cut(s) 327
FaeI CATG 2 cut(s) 105, 247
FaiI YATR 4 cut(s) 103, 150, 245, 377
FatI CATG 2 cut(s) 101, 243
FokI GGATG 1 cut(s) 325
FriOI GRGCYC 2 cut(s) 322, 336
GsaI CCCAGC 1 cut(s) 226
GsuI CTGGAG 2 cut(s) 96, 270
HaeIII GGCC 2 cut(s) 127, 326
Hin1II CATG 2 cut(s) 105, 247
HinfI GANTC 1 cut(s) 209
Hpy188I TCNGA 4 cut(s) 162, 214, 385, 413
Hpy188III TCNNGA 2 cut(s) 75, 244
HpyCH4III ACNGT 3 cut(s) 139, 381, 404
HpyCH4V TGCA 3 cut(s) 91, 275, 362
HpyF10VI GCNNNNNNNGC 2 cut(s) 59, 281
Hsp92II CATG 2 cut(s) 105, 247
LmnI GCTCC 3 cut(s) 251, 317, 331
LweI GCATC 2 cut(s) 120, 153
MaeIII GTNAC 2 cut(s) 232, 371
MboII GAAGA 3 cut(s) 149, 169, 401
MhlI GDGCHC 2 cut(s) 322, 336
MluCI AATT 3 cut(s) 63, 93, 118
MnlI CCTC 1 cut(s) 71
MseI TTAA 2 cut(s) 228, 290
MslI CAYNNNNRTG 1 cut(s) 300
MspR9I CCNGG 2 cut(s) 206, 323
MvaI CCWGG 2 cut(s) 206, 323
MwoI GCNNNNNNNGC 2 cut(s) 59, 281
NlaIII CATG 2 cut(s) 105, 247
NlaIV GGNNCC 1 cut(s) 319
NspI RCATGY 1 cut(s) 105
OliI CACNNNNGTG 1 cut(s) 300
PagI TCATGA 1 cut(s) 243
PfeI GAWTC 1 cut(s) 209
PfoI TCCNGGA 1 cut(s) 204
Psp124BI GAGCTC 1 cut(s) 336
Psp6I CCWGG 2 cut(s) 204, 321
PspFI CCCAGC 1 cut(s) 222
PspGI CCWGG 2 cut(s) 204, 321
PspN4I GGNNCC 1 cut(s) 319
RsaI GTAC 2 cut(s) 113, 357
RsaNI GTAC 2 cut(s) 112, 356
RseI CAYNNNNRTG 1 cut(s) 300
SacI GAGCTC 1 cut(s) 336
SaqAI TTAA 2 cut(s) 228, 290
ScrFI CCNGG 2 cut(s) 206, 323
SduI GDGCHC 2 cut(s) 322, 336
SetI ASST 4 cut(s) 224, 256, 336, 401
SfaNI GCATC 2 cut(s) 120, 153
SfcI CTRYAG 1 cut(s) 400
SmiMI CAYNNNNRTG 1 cut(s) 300
Sse9I AATT 3 cut(s) 63, 93, 118
SstI GAGCTC 1 cut(s) 336
StyD4I CCNGG 2 cut(s) 204, 321
StyI CCWWGG 1 cut(s) 327
TaaI ACNGT 3 cut(s) 139, 381, 404
TasI AATT 3 cut(s) 63, 93, 118
TatI WGTACW 2 cut(s) 111, 355
TfiI GAWTC 1 cut(s) 209
Tru1I TTAA 2 cut(s) 228, 290
Tru9I TTAA 2 cut(s) 228, 290
TspDTI ATGAA 2 cut(s) 232, 402
XapI RAATTY 1 cut(s) 93
XceI RCATGY 1 cut(s) 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.