Rh7AG247600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Forward (+)
24424571 .. 24432480
7910 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG247600.1

Sequence Viewer

Length: 201 bp
ATGATTGTCATTAAGAAGGCCATCCTGCCACCAGATCTTAAAGAGAACCTGAGGCTGAGATGTAAGGGCAGTAGGGCCACCATTCATGCACTTCGGCTCCGTACAGACAACGGTGCATTCAAAGGCTGTCTCAACACCAACAAAAAAGAGTTCAAAGTCGCACAAAGTACGGAAGTCGAAGTCTTCAAAGACCAAGGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.44

Weight (kDa)

9.94

Isoelectric Point (pI)

28.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 103, 169
AgsI TTSAA 3 cut(s) 121, 154, 187
Alw26I GTCTC 1 cut(s) 134
AoxI GGCC 2 cut(s) 18, 75
AspS9I GGNCC 1 cut(s) 75
AxyI CCTNAGG 1 cut(s) 50
BbsI GAAGAC 1 cut(s) 175
BccI CCATC 1 cut(s) 29
BcoDI GTCTC 1 cut(s) 134
BglII AGATCT 1 cut(s) 34
BmgT120I GGNCC 1 cut(s) 75
BmiI GGNNCC 1 cut(s) 98
BpiI GAAGAC 1 cut(s) 175
BsaJI CCNNGG 1 cut(s) 193
BsaXI ACNNNNNCTCC 2 cut(s) 81, 111
Bse21I CCTNAGG 1 cut(s) 50
BseDI CCNNGG 1 cut(s) 193
BseGI GGATG 1 cut(s) 21
BseMII CTCAG 2 cut(s) 41, 47
BshFI GGCC 2 cut(s) 20, 77
BsmAI GTCTC 1 cut(s) 134
BsmI GAATGC 1 cut(s) 116
BsnI GGCC 2 cut(s) 20, 77
Bsp143I GATC 1 cut(s) 34
BspANI GGCC 2 cut(s) 20, 77
BspCNI CTCAG 2 cut(s) 42, 48
BspLI GGNNCC 1 cut(s) 98
BssECI CCNNGG 1 cut(s) 193
BssMI GATC 1 cut(s) 34
BssT1I CCWWGG 1 cut(s) 193
Bst4CI ACNGT 1 cut(s) 113
BstDEI CTNAG 2 cut(s) 50, 56
BstF5I GGATG 1 cut(s) 21
BstKTI GATC 1 cut(s) 37
BstMAI GTCTC 1 cut(s) 134
BstMBI GATC 1 cut(s) 34
BstV2I GAAGAC 1 cut(s) 175
BstX2I RGATCY 1 cut(s) 34
BstYI RGATCY 1 cut(s) 34
Bsu36I CCTNAGG 1 cut(s) 50
BsuRI GGCC 2 cut(s) 20, 77
BtsCI GGATG 1 cut(s) 21
Cfr13I GGNCC 1 cut(s) 75
Csp6I GTAC 2 cut(s) 102, 168
CviAII CATG 1 cut(s) 86
CviJI RGCY 5 cut(s) 20, 55, 77, 97, 126
CviKI_1 RGCY 5 cut(s) 20, 55, 77, 97, 126
CviQI GTAC 2 cut(s) 102, 168
DdeI CTNAG 2 cut(s) 50, 56
DpnI GATC 1 cut(s) 36
DpnII GATC 1 cut(s) 34
Eco130I CCWWGG 1 cut(s) 193
Eco81I CCTNAGG 1 cut(s) 50
EcoT14I CCWWGG 1 cut(s) 193
ErhI CCWWGG 1 cut(s) 193
FaeI CATG 1 cut(s) 89
FaiI YATR 1 cut(s) 87
FatI CATG 1 cut(s) 85
FokI GGATG 1 cut(s) 8
HaeIII GGCC 2 cut(s) 20, 77
Hin1II CATG 1 cut(s) 89
HpyAV CCTTC 1 cut(s) 10
HpyCH4III ACNGT 1 cut(s) 113
HpyCH4V TGCA 2 cut(s) 89, 116
HpyF3I CTNAG 2 cut(s) 50, 56
Hsp92II CATG 1 cut(s) 89
Kzo9I GATC 1 cut(s) 34
LmnI GCTCC 1 cut(s) 102
LpnPI CCDG 3 cut(s) 38, 45, 62
MalI GATC 1 cut(s) 36
MboI GATC 1 cut(s) 34
MboII GAAGA 1 cut(s) 175
MflI RGATCY 1 cut(s) 34
MnlI CCTC 1 cut(s) 45
MseI TTAA 2 cut(s) 12, 39
Mva1269I GAATGC 1 cut(s) 116
NdeII GATC 1 cut(s) 34
NlaIII CATG 1 cut(s) 89
NlaIV GGNNCC 1 cut(s) 98
PctI GAATGC 1 cut(s) 116
PspN4I GGNNCC 1 cut(s) 98
PspPI GGNCC 1 cut(s) 75
PsuI RGATCY 1 cut(s) 34
RsaI GTAC 2 cut(s) 103, 169
RsaNI GTAC 2 cut(s) 102, 168
SaqAI TTAA 2 cut(s) 12, 39
Sau3AI GATC 1 cut(s) 34
Sau96I GGNCC 1 cut(s) 75
SetI ASST 1 cut(s) 51
SgeI CNNG 4 cut(s) 37, 44, 61, 98
StyI CCWWGG 1 cut(s) 193
TaaI ACNGT 1 cut(s) 113
TaqI TCGA 1 cut(s) 177
Tru1I TTAA 2 cut(s) 12, 39
Tru9I TTAA 2 cut(s) 12, 39
TspDTI ATGAA 1 cut(s) 74
TspGWI ACGGA 2 cut(s) 89, 185
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.