Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr7C

Orthogroup ID

OG0017436

Physical Location & Seq

Genomic Coordinates Forward (+)

36543525 .. 36543917

Gene Structure 393 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh7CG331000.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 393 bp

ATGGAGAGCGGTTTGTTGCAAGGGAGGCTTTGGGCTTTGGTGCAGCGTCAGGCTCGATCGGGGTCGCTGGTGGAGGAAGCGGTCGGTCTAGTTGAGGCAAGGCGGTGGGTCCGGCGAGTTGGTGCACTTCCAATGTGGTGGGCCAAGGGTTTTCCGCAGGAGGACATGACGGCGACGGCGGCGAAGGAGCAGCAGTGCAGAGAGGCTCCTCCTCTGTTTGCTTGGGGTTGGGCCTGGGTCTTTGGGCCTGGGATCAATATTGGGCTGCTGGGGCAGGGGTCGGGGCTCAATCTTGGGCTGCTGGACTTGTTTGATTTTCTTTCTGCTAGACAAGACTGGACTTGGGTTTGGGCCTACAGGCTTGGACTCGGGTCAAGGCAATTGGGGCCCTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

130

Amino Acids

14.54

Weight (kDa)

9.18

Isoelectric Point (pI)

44.64

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017436)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr4g0439221
rosa_multiflora	Rmu_sc0005501.1_g000001
rosa_roxburghii	Rroxscaffold_7G00169920 Rroxscaffold_7G00193780
rosa_samantha	Rh1AG089400 Rh1AG335100 Rh2BG629600 Rh2DG641500 Rh4CG083900 Rh4CG241600 Rh6AG201500 Rh7CG201700 Rh7CG331000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	9
AciI	CCGC	5 cut(s)	9, 80, 103, 155, 179
AclWI	GGATC	1 cut(s)	260
AjnI	CCWGG	2 cut(s)	233, 247
Alw21I	GWGCWC	1 cut(s)	127
Alw44I	GTGCAC	1 cut(s)	123
AlwI	GGATC	1 cut(s)	260
Ama87I	CYCGRG	1 cut(s)	368
AoxI	GGCC	5 cut(s)	141, 231, 245, 351, 386
ApaI	GGGCCC	1 cut(s)	390
ApaLI	GTGCAC	1 cut(s)	123
ApeKI	GCWGC	4 cut(s)	43, 190, 265, 298
AspS9I	GGNCC	7 cut(s)	109, 141, 231, 245, 351, 386, 387
AvaI	CYCGRG	1 cut(s)	368
AvaII	GGWCC	1 cut(s)	109
BaeGI	GKGCMC	2 cut(s)	127, 390
BanII	GRGCYC	2 cut(s)	288, 390
Bbv12I	GWGCWC	1 cut(s)	127
BbvI	GCAGC	4 cut(s)	55, 202, 252, 285
BceAI	ACGGC	2 cut(s)	186, 192
BciT130I	CCWGG	2 cut(s)	235, 249
BfaI	CTAG	2 cut(s)	89, 327
BfmI	CTRYAG	1 cut(s)	355
BisI	GCNGC	5 cut(s)	44, 180, 191, 266, 299
BlsI	GCNGC	5 cut(s)	45, 181, 192, 267, 300
Bme1390I	CCNGG	2 cut(s)	235, 249
Bme18I	GGWCC	1 cut(s)	109
BmeT110I	CYCGRG	1 cut(s)	368
BmgT120I	GGNCC	7 cut(s)	109, 141, 231, 245, 351, 386, 387
BmiI	GGNNCC	4 cut(s)	110, 207, 387, 388
BmrFI	CCNGG	2 cut(s)	235, 249
BoxI	GACNNNNGTC	1 cut(s)	370
BsaJI	CCNNGG	3 cut(s)	144, 234, 248
BsaXI	ACNNNNNCTCC	2 cut(s)	179, 209
Bse1I	ACTGG	1 cut(s)	341
BseBI	CCWGG	2 cut(s)	235, 249
BseDI	CCNNGG	3 cut(s)	144, 234, 248
BseNI	ACTGG	1 cut(s)	341
BseRI	GAGGAG	2 cut(s)	198, 201
BseSI	GKGCMC	2 cut(s)	127, 390
BseXI	GCAGC	4 cut(s)	55, 202, 252, 285
BseYI	CCCAGC	1 cut(s)	268
BsgI	GTGCAG	2 cut(s)	62, 217
Bsh1285I	CGRYCG	2 cut(s)	59, 84
BshFI	GGCC	5 cut(s)	143, 233, 247, 353, 388
BsiEI	CGRYCG	2 cut(s)	59, 84
BsiHKAI	GWGCWC	1 cut(s)	127
BsiHKCI	CYCGRG	1 cut(s)	368
BsiSI	CCGG	1 cut(s)	112
BsnI	GGCC	5 cut(s)	143, 233, 247, 353, 388
BsoBI	CYCGRG	1 cut(s)	368
Bsp120I	GGGCCC	1 cut(s)	386
Bsp1286I	GDGCHC	3 cut(s)	127, 288, 390
Bsp143I	GATC	2 cut(s)	56, 252
BspACI	CCGC	5 cut(s)	9, 80, 103, 155, 179
BspANI	GGCC	5 cut(s)	143, 233, 247, 353, 388
BspLI	GGNNCC	4 cut(s)	110, 207, 387, 388
BspPI	GGATC	1 cut(s)	260
BsrBI	CCGCTC	1 cut(s)	9
BsrI	ACTGG	1 cut(s)	341
BssECI	CCNNGG	3 cut(s)	144, 234, 248
BssMI	GATC	2 cut(s)	56, 252
BssT1I	CCWWGG	1 cut(s)	144
Bst2UI	CCWGG	2 cut(s)	235, 249
BstKTI	GATC	2 cut(s)	59, 255
BstMBI	GATC	2 cut(s)	56, 252
BstMCI	CGRYCG	2 cut(s)	59, 84
BstMWI	GCNNNNNNNGC	4 cut(s)	25, 179, 271, 385
BstNI	CCWGG	2 cut(s)	235, 249
BstPAI	GACNNNNGTC	1 cut(s)	370
BstSCI	CCNGG	2 cut(s)	233, 247
BstSFI	CTRYAG	1 cut(s)	355
BstSLI	GKGCMC	2 cut(s)	127, 390
BstV1I	GCAGC	4 cut(s)	55, 202, 252, 285
BstXI	CCANNNNNNTGG	1 cut(s)	138
BsuRI	GGCC	5 cut(s)	143, 233, 247, 353, 388
BtsI	GCAGTG	1 cut(s)	200
BtsIMutI	CAGTG	1 cut(s)	200
Cfr13I	GGNCC	7 cut(s)	109, 141, 231, 245, 351, 386, 387
CseI	GACGC	1 cut(s)	35
CviAII	CATG	1 cut(s)	166
DpnI	GATC	2 cut(s)	58, 254
DpnII	GATC	2 cut(s)	56, 252
Eco130I	CCWWGG	1 cut(s)	144
Eco24I	GRGCYC	2 cut(s)	288, 390
Eco47I	GGWCC	1 cut(s)	109
Eco88I	CYCGRG	1 cut(s)	368
EcoO109I	RGGNCCY	2 cut(s)	386, 387
EcoRII	CCWGG	2 cut(s)	233, 247
EcoT14I	CCWWGG	1 cut(s)	144
EcoT38I	GRGCYC	2 cut(s)	288, 390
ErhI	CCWWGG	1 cut(s)	144
FaeI	CATG	1 cut(s)	169
FaiI	YATR	1 cut(s)	167
FalI	AAGNNNNNCTT	2 cut(s)	12, 44
FatI	CATG	1 cut(s)	165
Fnu4HI	GCNGC	5 cut(s)	44, 180, 191, 266, 299
FriOI	GRGCYC	2 cut(s)	288, 390
Fsp4HI	GCNGC	5 cut(s)	44, 180, 191, 266, 299
FspBI	CTAG	2 cut(s)	89, 327
GluI	GCNGC	5 cut(s)	44, 180, 191, 266, 299
GsaI	CCCAGC	1 cut(s)	272
HaeIII	GGCC	5 cut(s)	143, 233, 247, 353, 388
HapII	CCGG	1 cut(s)	112
HgaI	GACGC	1 cut(s)	35
Hin1II	CATG	1 cut(s)	169
HinfI	GANTC	1 cut(s)	366
HpaII	CCGG	1 cut(s)	112
Hpy166II	GTNNAC	1 cut(s)	125
Hpy8I	GTNNAC	1 cut(s)	125
Hpy99I	CGWCG	1 cut(s)	178
HpyAV	CCTTC	1 cut(s)	178
HpyCH4V	TGCA	4 cut(s)	19, 43, 125, 198
HpyF10VI	GCNNNNNNNGC	4 cut(s)	25, 179, 271, 385
Hsp92II	CATG	1 cut(s)	169
Kzo9I	GATC	2 cut(s)	56, 252
LmnI	GCTCC	2 cut(s)	187, 211
Lsp1109I	GCAGC	4 cut(s)	55, 202, 252, 285
MaeI	CTAG	2 cut(s)	89, 327
MalI	GATC	2 cut(s)	58, 254
MbiI	CCGCTC	1 cut(s)	9
MboI	GATC	2 cut(s)	56, 252
MfeI	CAATTG	1 cut(s)	380
MhlI	GDGCHC	3 cut(s)	127, 288, 390
MluCI	AATT	1 cut(s)	380
MlyI	GAGTC	1 cut(s)	360
MnlI	CCTC	7 cut(s)	18, 67, 88, 154, 196, 219, 222
MspI	CCGG	1 cut(s)	112
MspR9I	CCNGG	2 cut(s)	235, 249
MunI	CAATTG	1 cut(s)	380
MvaI	CCWGG	2 cut(s)	235, 249
MwoI	GCNNNNNNNGC	4 cut(s)	25, 179, 271, 385
NdeII	GATC	2 cut(s)	56, 252
NlaIII	CATG	1 cut(s)	169
NlaIV	GGNNCC	4 cut(s)	110, 207, 387, 388
PkrI	GCNGC	5 cut(s)	45, 181, 192, 267, 300
Ple19I	CGATCG	1 cut(s)	59
PleI	GAGTC	1 cut(s)	360
PpsI	GAGTC	1 cut(s)	360
PshAI	GACNNNNGTC	1 cut(s)	370
Psp6I	CCWGG	2 cut(s)	233, 247
PspFI	CCCAGC	1 cut(s)	268
PspGI	CCWGG	2 cut(s)	233, 247
PspN4I	GGNNCC	4 cut(s)	110, 207, 387, 388
PspOMI	GGGCCC	1 cut(s)	386
PspPI	GGNCC	7 cut(s)	109, 141, 231, 245, 351, 386, 387
PvuI	CGATCG	1 cut(s)	59
SatI	GCNGC	5 cut(s)	44, 180, 191, 266, 299
Sau3AI	GATC	2 cut(s)	56, 252
Sau96I	GGNCC	7 cut(s)	109, 141, 231, 245, 351, 386, 387
SchI	GAGTC	1 cut(s)	360
ScrFI	CCNGG	2 cut(s)	235, 249
SduI	GDGCHC	3 cut(s)	127, 288, 390
SfcI	CTRYAG	1 cut(s)	355
SinI	GGWCC	1 cut(s)	109
Sse9I	AATT	1 cut(s)	380
SsiI	CCGC	5 cut(s)	9, 80, 103, 155, 179
SspI	AATATT	1 cut(s)	259
SspMI	CTAG	2 cut(s)	89, 327
StyD4I	CCNGG	2 cut(s)	233, 247
StyI	CCWWGG	1 cut(s)	144
TaqI	TCGA	1 cut(s)	55
TaqII	GACCGA	1 cut(s)	74
TasI	AATT	1 cut(s)	380
TauI	GCSGC	1 cut(s)	182
TscAI	CASTG	1 cut(s)	200
TseI	GCWGC	4 cut(s)	43, 190, 265, 298
TspRI	CASTG	1 cut(s)	200
VneI	GTGCAC	1 cut(s)	123
VpaK11BI	GGWCC	1 cut(s)	109
XspI	CTAG	2 cut(s)	89, 327

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.