Rh7CG457600

XIAP-associated factor 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
OG0012125
Physical Location & Seq
Forward (+)
60302687 .. 60306674
3988 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG457600.1

Sequence Viewer

Length: 444 bp
ATGAGATGTGTATTTGAACAGGTATCTTGTTCACTTTGTAGTGAGACAATGGAACGTGATATATTGGCAATCCACAAAGGTGAAAATTGTCCTCGAAGAATTGTCACATGCGAGTTCTGTGAGTTCCCATTGCCTGCTGTTGATCTAGCTGAGCATCAGGAAGTATGTGGCAATCGAACAGAACTTTGTCTTCGTTGTAGAAGATACGTTAGACTTCGAGAAAGATATAACCATGAGATTAATTGCAATAGTGTCTCAGAAAGTACCGTGGGACCTTCCAGGGATGCCAGGGAAGCTGAAAGAGGGCAAGATCCCCAAAGAAGAAGACAGCCTAATGAGTTCTCACGGAGAGGGCTTGTGTTCACCATTGCATTAACAGGCATTGCCGTTCTATTGGGATCCCTTTTTTTCCAGAAGAAGACAGAGGGCAGTCAAGTAAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

147

Amino Acids

16.9

Weight (kDa)

8.07

Isoelectric Point (pI)

54.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012125)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G09920
fragaria_vesca FvH4_5g34100 FvH4_5g34100
malus_domestica MD08G1206200.v1.1 MD15G1389500.v1.1
prunus_persica Prupe.1G538600_v2.0.a1 Prupe.1G538600_v2.0.a1
pyrus_communis pycom08g17820 pycom15g34910
rosa_chinensis RchiOBHm_Chr7g0233601
rosa_laevigata RLG00000001250
rosa_multiflora Rmu_sc0003712.1_g000011
rosa_roxburghii Rroxscaffold_3G00227120
rosa_rugosa Rorug07G0281400
rosa_samantha Rh7AG438000 Rh7BG410700 Rh7CG457600 Rh7DG426900
rosa_wichuraiana Rw7G036120

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 305, 393, 406
AfaI GTAC 1 cut(s) 265
AgsI TTSAA 1 cut(s) 17
AjnI CCWGG 2 cut(s) 278, 287
AleI CACNNNNGTG 1 cut(s) 78
AluBI AGCT 2 cut(s) 149, 296
AluI AGCT 2 cut(s) 149, 296
Alw26I GTCTC 2 cut(s) 38, 259
AlwI GGATC 3 cut(s) 305, 393, 406
AseI ATTAAT 1 cut(s) 240
AspS9I GGNCC 1 cut(s) 272
AsuHPI GGTGA 2 cut(s) 92, 355
AvaII GGWCC 1 cut(s) 272
BamHI GGATCC 1 cut(s) 398
BbsI GAAGAC 3 cut(s) 182, 331, 425
BceAI ACGGC 1 cut(s) 371
BciT130I CCWGG 2 cut(s) 280, 289
BcoDI GTCTC 2 cut(s) 38, 259
BfaI CTAG 1 cut(s) 146
BlpI GCTNAGC 1 cut(s) 150
Bme1390I CCNGG 2 cut(s) 280, 289
Bme18I GGWCC 1 cut(s) 272
BmgT120I GGNCC 1 cut(s) 272
BmiI GGNNCC 2 cut(s) 273, 400
BmrFI CCNGG 2 cut(s) 280, 289
BmsI GCATC 2 cut(s) 163, 274
BpiI GAAGAC 3 cut(s) 182, 331, 425
Bpu1102I GCTNAGC 1 cut(s) 150
BsaJI CCNNGG 3 cut(s) 267, 279, 288
Bse3DI GCAATG 3 cut(s) 128, 366, 381
BseBI CCWGG 2 cut(s) 280, 289
BseDI CCNNGG 3 cut(s) 267, 279, 288
BseGI GGATG 1 cut(s) 289
BseMI GCAATG 3 cut(s) 128, 366, 381
BseMII CTCAG 2 cut(s) 141, 270
BslFI GGGAC 1 cut(s) 285
BsmAI GTCTC 2 cut(s) 38, 259
BsmFI GGGAC 1 cut(s) 285
Bsp143I GATC 3 cut(s) 142, 310, 398
Bsp1720I GCTNAGC 1 cut(s) 150
BspCNI CTCAG 2 cut(s) 142, 269
BspLI GGNNCC 2 cut(s) 273, 400
BspPI GGATC 3 cut(s) 305, 393, 406
BsrDI GCAATG 3 cut(s) 128, 366, 381
BssECI CCNNGG 3 cut(s) 267, 279, 288
BssMI GATC 3 cut(s) 142, 310, 398
Bst2UI CCWGG 2 cut(s) 280, 289
Bst4CI ACNGT 1 cut(s) 268
BstC8I GCNNGC 1 cut(s) 135
BstDEI CTNAG 2 cut(s) 150, 256
BstDSI CCRYGG 1 cut(s) 267
BstF5I GGATG 1 cut(s) 289
BstKTI GATC 3 cut(s) 145, 313, 401
BstMAI GTCTC 2 cut(s) 38, 259
BstMBI GATC 3 cut(s) 142, 310, 398
BstMWI GCNNNNNNNGC 1 cut(s) 293
BstNI CCWGG 2 cut(s) 280, 289
BstNSI RCATGY 1 cut(s) 111
BstSCI CCNGG 2 cut(s) 278, 287
BstV2I GAAGAC 3 cut(s) 182, 331, 425
BstX2I RGATCY 2 cut(s) 310, 398
BstYI RGATCY 2 cut(s) 310, 398
BtgI CCRYGG 1 cut(s) 267
BtsCI GGATG 1 cut(s) 289
Cac8I GCNNGC 1 cut(s) 135
Cfr13I GGNCC 1 cut(s) 272
Csp6I GTAC 1 cut(s) 264
CviAII CATG 2 cut(s) 108, 233
CviJI RGCY 4 cut(s) 149, 296, 331, 355
CviKI_1 RGCY 4 cut(s) 149, 296, 331, 355
CviQI GTAC 1 cut(s) 264
DdeI CTNAG 2 cut(s) 150, 256
DpnI GATC 3 cut(s) 144, 312, 400
DpnII GATC 3 cut(s) 142, 310, 398
Eco47I GGWCC 1 cut(s) 272
EcoO109I RGGNCCY 1 cut(s) 272
EcoRII CCWGG 2 cut(s) 278, 287
FaeI CATG 2 cut(s) 111, 236
FaiI YATR 5 cut(s) 62, 109, 166, 228, 234
FaqI GGGAC 1 cut(s) 285
FatI CATG 2 cut(s) 107, 232
FokI GGATG 1 cut(s) 296
FspBI CTAG 1 cut(s) 146
Hin1II CATG 2 cut(s) 111, 236
HphI GGTGA 2 cut(s) 92, 355
Hpy166II GTNNAC 2 cut(s) 32, 363
Hpy188I TCNGA 1 cut(s) 259
Hpy188III TCNNGA 3 cut(s) 158, 218, 412
Hpy8I GTNNAC 2 cut(s) 32, 363
HpyAV CCTTC 1 cut(s) 285
HpyCH4III ACNGT 1 cut(s) 268
HpyCH4IV ACGT 2 cut(s) 55, 207
HpyCH4V TGCA 2 cut(s) 246, 371
HpyF10VI GCNNNNNNNGC 1 cut(s) 293
HpyF3I CTNAG 2 cut(s) 150, 256
HpySE526I ACGT 2 cut(s) 55, 207
Hsp92II CATG 2 cut(s) 111, 236
Kzo9I GATC 3 cut(s) 142, 310, 398
LpnPI CCDG 9 cut(s) 5, 143, 147, 265, 274, 292, 301, 363, 425
LweI GCATC 2 cut(s) 163, 274
MaeI CTAG 1 cut(s) 146
MaeII ACGT 2 cut(s) 55, 207
MaeIII GTNAC 1 cut(s) 103
MalI GATC 3 cut(s) 144, 312, 400
MboI GATC 3 cut(s) 142, 310, 398
MboII GAAGA 7 cut(s) 108, 182, 213, 333, 336, 427, 430
MflI RGATCY 2 cut(s) 310, 398
MluCI AATT 4 cut(s) 85, 99, 241, 439
MnlI CCTC 4 cut(s) 102, 296, 344, 418
MseI TTAA 2 cut(s) 240, 374
MslI CAYNNNNRTG 1 cut(s) 78
MspR9I CCNGG 2 cut(s) 280, 289
MvaI CCWGG 2 cut(s) 280, 289
MwoI GCNNNNNNNGC 1 cut(s) 293
NdeII GATC 3 cut(s) 142, 310, 398
NlaIII CATG 2 cut(s) 111, 236
NlaIV GGNNCC 2 cut(s) 273, 400
NmuCI GTSAC 1 cut(s) 103
NspI RCATGY 1 cut(s) 111
OliI CACNNNNGTG 1 cut(s) 78
PpuMI RGGWCCY 1 cut(s) 272
PshBI ATTAAT 1 cut(s) 240
Psp5II RGGWCCY 1 cut(s) 272
Psp6I CCWGG 2 cut(s) 278, 287
PspGI CCWGG 2 cut(s) 278, 287
PspN4I GGNNCC 2 cut(s) 273, 400
PspPI GGNCC 1 cut(s) 272
PspPPI RGGWCCY 1 cut(s) 272
PsuI RGATCY 2 cut(s) 310, 398
RsaI GTAC 1 cut(s) 265
RsaNI GTAC 1 cut(s) 264
RseI CAYNNNNRTG 1 cut(s) 78
SaqAI TTAA 2 cut(s) 240, 374
Sau3AI GATC 3 cut(s) 142, 310, 398
Sau96I GGNCC 1 cut(s) 272
ScrFI CCNGG 2 cut(s) 280, 289
SetI ASST 7 cut(s) 24, 58, 82, 151, 210, 277, 298
SfaNI GCATC 2 cut(s) 163, 274
SinI GGWCC 1 cut(s) 272
SmiMI CAYNNNNRTG 1 cut(s) 78
Sse9I AATT 4 cut(s) 85, 99, 241, 439
SspMI CTAG 1 cut(s) 146
StyD4I CCNGG 2 cut(s) 278, 287
TaaI ACNGT 1 cut(s) 268
TaiI ACGT 2 cut(s) 58, 210
TaqI TCGA 3 cut(s) 94, 175, 217
TasI AATT 4 cut(s) 85, 99, 241, 439
Tru1I TTAA 2 cut(s) 240, 374
Tru9I TTAA 2 cut(s) 240, 374
TseFI GTSAC 1 cut(s) 103
Tsp45I GTSAC 1 cut(s) 103
TspGWI ACGGA 1 cut(s) 361
VpaK11BI GGWCC 1 cut(s) 272
VspI ATTAAT 1 cut(s) 240
XceI RCATGY 1 cut(s) 111
XspI CTAG 1 cut(s) 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.