Rw7G036120

XIAP-associated factor 1-like

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr7
Physical Location & Seq
Forward (+)
54440561 .. 54444636
4076 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw7G036120.1

Sequence Viewer

Length: 603 bp
ATGGCTCTTGCATCTGATGAAGCTAACAGGATATGCAATCACTGTGAAAGAGCTATCCCGTCTTTAAATATTGATTTGCATTATGCTCACTGTGTCCGCAATCTGGAAAGATGTAAAGTTTGTGGTGACATGGTTCCAAAAAAACATGCTGAGGAACATTACTTAGGCAACCATGCTCCGGTATCTTGTTCACTTTGTAGTGAGACAATGGAACGTGATATATTGGCAATCCACAAAGGTGAAAATTGTCCTCGAAGAATTGTCACATGCGAGTTCTGTGAGTTCCCATTGCCTGCTGTTGATCTAGCTGAGCATCAGGAAGTATGTGGCAATCGAACAGAACTTTGTCTTCATTGTAGAAGATACGTTAGACTTCGAGAAAGATATAACCATGAGACTAGTTGCAATAGTGCCACAGAAAATACCGTGGGACCTGCCAGGGATGCCAGGGAAGCTGAAAGAGGGCAAGGCCCCCAAAGAAGAAGACAGCCAAATGAGTTTTCACGGAGAGGGCTTGTGTTCACCATTGCATTAACAGGCATTGCCGTTCTATTGGGATCTCTTTTTTTCCAGAAGAAGACAGAGGGCAGTCAAGTAAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

200

Amino Acids

22.66

Weight (kDa)

7.54

Isoelectric Point (pI)

51.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012125)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 442
AciI CCGC 1 cut(s) 97
AclWI GGATC 1 cut(s) 565
AfiI CCNNNNNNNGG 2 cut(s) 103, 178
AhlI ACTAGT 1 cut(s) 398
AjnI CCWGG 2 cut(s) 437, 446
AjuI GAANNNNNNNTTGG 2 cut(s) 484, 516
AleI CACNNNNGTG 1 cut(s) 237
AluBI AGCT 4 cut(s) 23, 53, 308, 455
AluI AGCT 4 cut(s) 23, 53, 308, 455
Alw26I GTCTC 2 cut(s) 197, 389
AlwI GGATC 1 cut(s) 565
AoxI GGCC 1 cut(s) 469
AspS9I GGNCC 2 cut(s) 431, 470
AsuHPI GGTGA 3 cut(s) 137, 251, 514
AvaII GGWCC 1 cut(s) 431
BbsI GAAGAC 3 cut(s) 341, 490, 584
BbvCI CCTCAGC 1 cut(s) 150
BceAI ACGGC 1 cut(s) 530
BciT130I CCWGG 2 cut(s) 439, 448
BcoDI GTCTC 2 cut(s) 197, 389
BcuI ACTAGT 1 cut(s) 398
BfaI CTAG 2 cut(s) 305, 399
BfuAI ACCTGC 1 cut(s) 442
BlpI GCTNAGC 1 cut(s) 309
Bme1390I CCNGG 2 cut(s) 439, 448
Bme18I GGWCC 1 cut(s) 431
BmgT120I GGNCC 2 cut(s) 431, 470
BmiI GGNNCC 3 cut(s) 135, 432, 472
BmrFI CCNGG 2 cut(s) 439, 448
BmsI GCATC 3 cut(s) 20, 322, 433
BpiI GAAGAC 3 cut(s) 341, 490, 584
Bpu10I CCTNAGC 1 cut(s) 150
Bpu1102I GCTNAGC 1 cut(s) 309
BsaJI CCNNGG 3 cut(s) 426, 438, 447
BsaWI WCCGGW 1 cut(s) 178
Bsc4I CCNNNNNNNGG 2 cut(s) 103, 178
Bse3DI GCAATG 3 cut(s) 287, 525, 540
BseBI CCWGG 2 cut(s) 439, 448
BseDI CCNNGG 3 cut(s) 426, 438, 447
BseGI GGATG 1 cut(s) 448
BseLI CCNNNNNNNGG 2 cut(s) 103, 178
BseMI GCAATG 3 cut(s) 287, 525, 540
BseMII CTCAG 2 cut(s) 141, 300
BshFI GGCC 1 cut(s) 471
BsiSI CCGG 1 cut(s) 179
BslFI GGGAC 1 cut(s) 444
BslI CCNNNNNNNGG 2 cut(s) 103, 178
BsmAI GTCTC 2 cut(s) 197, 389
BsmFI GGGAC 1 cut(s) 444
BsnI GGCC 1 cut(s) 471
Bsp143I GATC 2 cut(s) 301, 557
Bsp1720I GCTNAGC 1 cut(s) 309
BspACI CCGC 1 cut(s) 97
BspANI GGCC 1 cut(s) 471
BspCNI CTCAG 2 cut(s) 142, 301
BspLI GGNNCC 3 cut(s) 135, 432, 472
BspMI ACCTGC 1 cut(s) 442
BspPI GGATC 1 cut(s) 565
BsrDI GCAATG 3 cut(s) 287, 525, 540
BssECI CCNNGG 3 cut(s) 426, 438, 447
BssMI GATC 2 cut(s) 301, 557
Bst2UI CCWGG 2 cut(s) 439, 448
Bst4CI ACNGT 3 cut(s) 44, 92, 427
BstC8I GCNNGC 1 cut(s) 294
BstDEI CTNAG 3 cut(s) 150, 163, 309
BstDSI CCRYGG 1 cut(s) 426
BstF5I GGATG 1 cut(s) 448
BstKTI GATC 2 cut(s) 304, 560
BstMAI GTCTC 2 cut(s) 197, 389
BstMBI GATC 2 cut(s) 301, 557
BstMWI GCNNNNNNNGC 2 cut(s) 443, 452
BstNI CCWGG 2 cut(s) 439, 448
BstNSI RCATGY 2 cut(s) 149, 270
BstSCI CCNGG 2 cut(s) 437, 446
BstV2I GAAGAC 3 cut(s) 341, 490, 584
BstX2I RGATCY 1 cut(s) 557
BstYI RGATCY 1 cut(s) 557
BsuRI GGCC 1 cut(s) 471
BtgI CCRYGG 1 cut(s) 426
BtsCI GGATG 1 cut(s) 448
BtsIMutI CAGTG 2 cut(s) 40, 88
BveI ACCTGC 1 cut(s) 442
Cac8I GCNNGC 1 cut(s) 294
Cfr13I GGNCC 2 cut(s) 431, 470
CviAII CATG 5 cut(s) 130, 146, 173, 267, 392
CviJI RGCY 8 cut(s) 5, 23, 53, 308, 455, 471, 490, 514
CviKI_1 RGCY 8 cut(s) 5, 23, 53, 308, 455, 471, 490, 514
DdeI CTNAG 3 cut(s) 150, 163, 309
DpnI GATC 2 cut(s) 303, 559
DpnII GATC 2 cut(s) 301, 557
DraI TTTAAA 1 cut(s) 66
Eco47I GGWCC 1 cut(s) 431
EcoO109I RGGNCCY 2 cut(s) 431, 470
EcoRII CCWGG 2 cut(s) 437, 446
FaeI CATG 5 cut(s) 133, 149, 176, 270, 395
FaqI GGGAC 1 cut(s) 444
FatI CATG 5 cut(s) 129, 145, 172, 266, 391
FokI GGATG 1 cut(s) 455
FspBI CTAG 2 cut(s) 305, 399
HaeIII GGCC 1 cut(s) 471
HapII CCGG 1 cut(s) 179
Hin1II CATG 5 cut(s) 133, 149, 176, 270, 395
HpaII CCGG 1 cut(s) 179
HphI GGTGA 3 cut(s) 137, 251, 514
Hpy166II GTNNAC 2 cut(s) 191, 522
Hpy188I TCNGA 1 cut(s) 16
Hpy188III TCNNGA 4 cut(s) 104, 317, 377, 571
Hpy8I GTNNAC 2 cut(s) 191, 522
HpyCH4III ACNGT 3 cut(s) 44, 92, 427
HpyCH4IV ACGT 2 cut(s) 214, 366
HpyCH4V TGCA 5 cut(s) 11, 36, 79, 405, 530
HpyF10VI GCNNNNNNNGC 2 cut(s) 443, 452
HpyF3I CTNAG 3 cut(s) 150, 163, 309
HpySE526I ACGT 2 cut(s) 214, 366
Hsp92II CATG 5 cut(s) 133, 149, 176, 270, 395
Kzo9I GATC 2 cut(s) 301, 557
LmnI GCTCC 1 cut(s) 181
LweI GCATC 3 cut(s) 20, 322, 433
MaeI CTAG 2 cut(s) 305, 399
MaeII ACGT 2 cut(s) 214, 366
MaeIII GTNAC 2 cut(s) 125, 262
MalI GATC 2 cut(s) 303, 559
MboI GATC 2 cut(s) 301, 557
MboII GAAGA 7 cut(s) 267, 341, 372, 492, 495, 586, 589
MflI RGATCY 1 cut(s) 557
MluCI AATT 3 cut(s) 244, 258, 598
MnlI CCTC 5 cut(s) 145, 261, 455, 503, 577
MseI TTAA 2 cut(s) 65, 533
MslI CAYNNNNRTG 1 cut(s) 237
MspI CCGG 1 cut(s) 179
MspR9I CCNGG 2 cut(s) 439, 448
MvaI CCWGG 2 cut(s) 439, 448
MwoI GCNNNNNNNGC 2 cut(s) 443, 452
NdeII GATC 2 cut(s) 301, 557
NlaIII CATG 5 cut(s) 133, 149, 176, 270, 395
NlaIV GGNNCC 3 cut(s) 135, 432, 472
NmuCI GTSAC 2 cut(s) 125, 262
NspI RCATGY 2 cut(s) 149, 270
OliI CACNNNNGTG 1 cut(s) 237
PpuMI RGGWCCY 1 cut(s) 431
Psp5II RGGWCCY 1 cut(s) 431
Psp6I CCWGG 2 cut(s) 437, 446
PspGI CCWGG 2 cut(s) 437, 446
PspN4I GGNNCC 3 cut(s) 135, 432, 472
PspPI GGNCC 2 cut(s) 431, 470
PspPPI RGGWCCY 1 cut(s) 431
PsuI RGATCY 1 cut(s) 557
RseI CAYNNNNRTG 1 cut(s) 237
SaqAI TTAA 2 cut(s) 65, 533
Sau3AI GATC 2 cut(s) 301, 557
Sau96I GGNCC 2 cut(s) 431, 470
ScrFI CCNGG 2 cut(s) 439, 448
SetI ASST 8 cut(s) 25, 55, 217, 241, 310, 369, 436, 457
SfaNI GCATC 3 cut(s) 20, 322, 433
SinI GGWCC 1 cut(s) 431
SmiMI CAYNNNNRTG 1 cut(s) 237
SpeI ACTAGT 1 cut(s) 398
Sse9I AATT 3 cut(s) 244, 258, 598
SsiI CCGC 1 cut(s) 97
SspI AATATT 1 cut(s) 70
SspMI CTAG 2 cut(s) 305, 399
StyD4I CCNGG 2 cut(s) 437, 446
TaaI ACNGT 3 cut(s) 44, 92, 427
TaiI ACGT 2 cut(s) 217, 369
TaqI TCGA 3 cut(s) 253, 334, 376
TasI AATT 3 cut(s) 244, 258, 598
Tru1I TTAA 2 cut(s) 65, 533
Tru9I TTAA 2 cut(s) 65, 533
TscAI CASTG 2 cut(s) 47, 95
TseFI GTSAC 2 cut(s) 125, 262
Tsp45I GTSAC 2 cut(s) 125, 262
TspDTI ATGAA 2 cut(s) 33, 341
TspGWI ACGGA 1 cut(s) 520
TspRI CASTG 2 cut(s) 47, 95
VpaK11BI GGWCC 1 cut(s) 431
XceI RCATGY 2 cut(s) 149, 270
XspI CTAG 2 cut(s) 305, 399
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.