Rh7DG449100

Bet1-like protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
63760578 .. 63763552
2975 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG449100.1

Sequence Viewer

Length: 177 bp
ATGTCGGTGGCTCAAGAGATTGAGGTTGAAGCCAAATCTCAGAATGCTATGCTCAATCAGCTGGACATGACAGTGATGAAAGCTCAAGCATGGTTGAAGAATAATGTCAGGAGATTGAACAAGAGCACCATCCAGAGTGGTTCAAACCATGTTGTCCATGTGATTACAAAAGTATGA

Protein Analysis

58

Amino Acids

6.52

Weight (kDa)

9.82

Isoelectric Point (pI)

53.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011975)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 4 cut(s) 29, 97, 118, 144
AluBI AGCT 2 cut(s) 61, 83
AluI AGCT 2 cut(s) 61, 83
Alw21I GWGCWC 1 cut(s) 128
Bbv12I GWGCWC 1 cut(s) 128
BccI CCATC 1 cut(s) 137
BpuEI CTTGAG 1 cut(s) 69
BseGI GGATG 1 cut(s) 129
BseMII CTCAG 1 cut(s) 53
BsiHKAI GWGCWC 1 cut(s) 128
BsmI GAATGC 1 cut(s) 49
Bsp1286I GDGCHC 1 cut(s) 128
BspCNI CTCAG 1 cut(s) 52
Bst4CI ACNGT 1 cut(s) 73
BstDEI CTNAG 1 cut(s) 39
BstF5I GGATG 1 cut(s) 129
BstMWI GCNNNNNNNGC 1 cut(s) 58
BtsCI GGATG 1 cut(s) 129
BtsIMutI CAGTG 1 cut(s) 78
CviAII CATG 4 cut(s) 67, 90, 149, 158
CviJI RGCY 4 cut(s) 11, 32, 61, 83
CviKI_1 RGCY 4 cut(s) 11, 32, 61, 83
DdeI CTNAG 1 cut(s) 39
FaeI CATG 4 cut(s) 70, 93, 152, 161
FaiI YATR 6 cut(s) 50, 68, 91, 150, 159, 175
FatI CATG 4 cut(s) 66, 89, 148, 157
FokI GGATG 1 cut(s) 116
Hin1II CATG 4 cut(s) 70, 93, 152, 161
Hpy188I TCNGA 1 cut(s) 42
Hpy188III TCNNGA 3 cut(s) 14, 109, 133
HpyCH4III ACNGT 1 cut(s) 73
HpyF10VI GCNNNNNNNGC 1 cut(s) 58
HpyF3I CTNAG 1 cut(s) 39
Hsp92II CATG 4 cut(s) 70, 93, 152, 161
LpnPI CCDG 3 cut(s) 47, 94, 146
MboII GAAGA 1 cut(s) 109
MhlI GDGCHC 1 cut(s) 128
MnlI CCTC 1 cut(s) 16
MslI CAYNNNNRTG 1 cut(s) 71
MspA1I CMGCKG 1 cut(s) 61
Mva1269I GAATGC 1 cut(s) 49
MwoI GCNNNNNNNGC 1 cut(s) 58
NlaIII CATG 4 cut(s) 70, 93, 152, 161
PctI GAATGC 1 cut(s) 49
PvuII CAGCTG 1 cut(s) 61
RseI CAYNNNNRTG 1 cut(s) 71
SduI GDGCHC 1 cut(s) 128
SetI ASST 3 cut(s) 27, 63, 85
SmiMI CAYNNNNRTG 1 cut(s) 71
SmlI CTYRAG 2 cut(s) 12, 84
SmoI CTYRAG 2 cut(s) 12, 84
TaaI ACNGT 1 cut(s) 73
TscAI CASTG 1 cut(s) 78
TspDTI ATGAA 1 cut(s) 92
TspRI CASTG 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.