Rw4G026640

Cyclic nucleotide-gated ion channel 1-like

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr4
Physical Location & Seq
Reverse (-)
52855209 .. 52856441
1233 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw4G026640.1

Sequence Viewer

Length: 642 bp
ATGTTACAAGGGCATCTGTCAATATCCTCTCTGAGACTACATGGGCTAATCTCTCCTTTTTTTCTACTTGCTAGTCATGTGCTTGGAGCTTTTTGGTATTTATTTTCCATAGAAAGGAAAACAACTTGTTGGGTAGAAGTATGTAAAATTCAAGGTGTTGCTTGTTCTTTGTATTGCGATGACACCATGGTACTTAACCCACTCCAACTGATCAATGATTACTCTTGCTCTACAAAGACCAATAACACAGCCTTTGATTATGGAATATCCCTTCATGCTCTCGAATCGGGTGTCGTCTATTCAGATAATTTTCTACAAAAGATTTCTCTCTGCTTATGGTGGGGACTGCAAAACATAAGCTCCTTTGGTCAAAGTCTCAAAACAAATACCTATGTGTGGGAGATCTACTTTTCAATTGTCGTTTCAATTTCTGGCTTGGTACTGTTTGCATTATTTATTGGAAATATACAGACGTACTTGAATTCGCAAGCTGAAAGAGTGAAGGAAATGAAATCGAACGGGCAAGAGATTGAATTGTGGATGGACTTTCATTCACTTCCTAAGTGGCTTAAGACTCGGTTCAGGAAGTATCAGAAATATAGATGGCAAGAAAGGTATCAGCCAACTCCTCAGCATGTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

213

Amino Acids

24.76

Weight (kDa)

8.48

Isoelectric Point (pI)

42.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ion_trans PF00520 21 - 166 1.6e-06 Ion transport protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 147, 481
AfaI GTAC 3 cut(s) 192, 441, 476
AfiI CCNNNNNNNGG 2 cut(s) 114, 396
AflII CTTAAG 1 cut(s) 569
AgsI TTSAA 5 cut(s) 152, 414, 426, 481, 533
AluBI AGCT 3 cut(s) 89, 360, 491
AluI AGCT 3 cut(s) 89, 360, 491
Alw26I GTCTC 2 cut(s) 28, 380
ApoI RAATTY 2 cut(s) 147, 481
ArsI GACNNNNNNTTYG 2 cut(s) 276, 308
BbvCI CCTCAGC 1 cut(s) 630
BccI CCATC 2 cut(s) 535, 597
BclI TGATCA 1 cut(s) 210
BcoDI GTCTC 2 cut(s) 28, 380
BfaI CTAG 1 cut(s) 72
BfrI CTTAAG 1 cut(s) 569
BglII AGATCT 1 cut(s) 402
BmsI GCATC 1 cut(s) 22
Bpu10I CCTNAGC 1 cut(s) 630
BsaJI CCNNGG 1 cut(s) 186
BsaXI ACNNNNNCTCC 2 cut(s) 344, 374
Bsc4I CCNNNNNNNGG 2 cut(s) 114, 396
BseDI CCNNGG 1 cut(s) 186
BseGI GGATG 1 cut(s) 546
BseLI CCNNNNNNNGG 2 cut(s) 114, 396
BseMII CTCAG 1 cut(s) 23
BseRI GAGGAG 1 cut(s) 618
BslFI GGGAC 1 cut(s) 357
BslI CCNNNNNNNGG 2 cut(s) 114, 396
BsmAI GTCTC 2 cut(s) 28, 380
BsmFI GGGAC 1 cut(s) 357
Bsp143I GATC 2 cut(s) 210, 402
Bsp19I CCATGG 1 cut(s) 186
BspCNI CTCAG 1 cut(s) 24
BspTI CTTAAG 1 cut(s) 569
BssECI CCNNGG 1 cut(s) 186
BssMI GATC 2 cut(s) 210, 402
BssT1I CCWWGG 1 cut(s) 186
Bst4CI ACNGT 1 cut(s) 444
BstAFI CTTAAG 1 cut(s) 569
BstC8I GCNNGC 1 cut(s) 489
BstDEI CTNAG 3 cut(s) 32, 561, 630
BstDSI CCRYGG 1 cut(s) 186
BstF5I GGATG 1 cut(s) 546
BstKTI GATC 2 cut(s) 213, 405
BstMAI GTCTC 2 cut(s) 28, 380
BstMBI GATC 2 cut(s) 210, 402
BstNSI RCATGY 1 cut(s) 638
BstX2I RGATCY 1 cut(s) 402
BstYI RGATCY 1 cut(s) 402
BtgI CCRYGG 1 cut(s) 186
BtgZI GCGATG 1 cut(s) 192
BtsCI GGATG 1 cut(s) 546
Cac8I GCNNGC 1 cut(s) 489
Csp6I GTAC 3 cut(s) 191, 440, 475
CviAII CATG 5 cut(s) 41, 77, 187, 275, 635
CviJI RGCY 8 cut(s) 46, 89, 251, 360, 435, 491, 568, 622
CviKI_1 RGCY 8 cut(s) 46, 89, 251, 360, 435, 491, 568, 622
CviQI GTAC 3 cut(s) 191, 440, 475
DdeI CTNAG 3 cut(s) 32, 561, 630
DpnI GATC 2 cut(s) 212, 404
DpnII GATC 2 cut(s) 210, 402
Eco130I CCWWGG 1 cut(s) 186
EcoRI GAATTC 1 cut(s) 481
EcoT14I CCWWGG 1 cut(s) 186
ErhI CCWWGG 1 cut(s) 186
FaeI CATG 5 cut(s) 44, 80, 190, 278, 638
FaqI GGGAC 1 cut(s) 357
FatI CATG 5 cut(s) 40, 76, 186, 274, 634
FbaI TGATCA 1 cut(s) 210
FokI GGATG 1 cut(s) 553
FspBI CTAG 1 cut(s) 72
Hin1II CATG 5 cut(s) 44, 80, 190, 278, 638
HinfI GANTC 2 cut(s) 284, 574
Hpy188I TCNGA 3 cut(s) 33, 304, 594
Hpy188III TCNNGA 2 cut(s) 281, 583
HpyAV CCTTC 2 cut(s) 281, 496
HpyCH4III ACNGT 1 cut(s) 444
HpyCH4IV ACGT 1 cut(s) 473
HpyCH4V TGCA 2 cut(s) 349, 449
HpyF3I CTNAG 3 cut(s) 32, 561, 630
HpySE526I ACGT 1 cut(s) 473
Hsp92II CATG 5 cut(s) 44, 80, 190, 278, 638
Ksp22I TGATCA 1 cut(s) 210
Kzo9I GATC 2 cut(s) 210, 402
LmnI GCTCC 2 cut(s) 86, 365
LpnPI CCDG 2 cut(s) 417, 568
LweI GCATC 1 cut(s) 22
MaeI CTAG 1 cut(s) 72
MaeII ACGT 1 cut(s) 473
MaeIII GTNAC 1 cut(s) 3
MalI GATC 2 cut(s) 212, 404
MboI GATC 2 cut(s) 210, 402
MfeI CAATTG 1 cut(s) 414
MflI RGATCY 1 cut(s) 402
MluCI AATT 6 cut(s) 147, 307, 414, 426, 481, 533
MlyI GAGTC 1 cut(s) 568
MmeI TCCRAC 1 cut(s) 229
MnlI CCTC 2 cut(s) 37, 639
MseI TTAA 2 cut(s) 195, 570
MspCI CTTAAG 1 cut(s) 569
MunI CAATTG 1 cut(s) 414
NcoI CCATGG 1 cut(s) 186
NdeII GATC 2 cut(s) 210, 402
NlaIII CATG 5 cut(s) 44, 80, 190, 278, 638
NspI RCATGY 1 cut(s) 638
PfeI GAWTC 1 cut(s) 284
PleI GAGTC 1 cut(s) 568
PpsI GAGTC 1 cut(s) 568
PsuI RGATCY 1 cut(s) 402
RsaI GTAC 3 cut(s) 192, 441, 476
RsaNI GTAC 3 cut(s) 191, 440, 475
SaqAI TTAA 2 cut(s) 195, 570
Sau3AI GATC 2 cut(s) 210, 402
SchI GAGTC 1 cut(s) 568
SetI ASST 7 cut(s) 91, 157, 362, 392, 476, 493, 617
SfaNI GCATC 1 cut(s) 22
SmlI CTYRAG 1 cut(s) 569
SmoI CTYRAG 1 cut(s) 569
Sse9I AATT 6 cut(s) 147, 307, 414, 426, 481, 533
SspMI CTAG 1 cut(s) 72
StyI CCWWGG 1 cut(s) 186
TaaI ACNGT 1 cut(s) 444
TaiI ACGT 1 cut(s) 476
TaqI TCGA 2 cut(s) 282, 515
TasI AATT 6 cut(s) 147, 307, 414, 426, 481, 533
TfiI GAWTC 1 cut(s) 284
Tru1I TTAA 2 cut(s) 195, 570
Tru9I TTAA 2 cut(s) 195, 570
TspDTI ATGAA 3 cut(s) 263, 524, 539
Vha464I CTTAAG 1 cut(s) 569
XapI RAATTY 2 cut(s) 147, 481
XceI RCATGY 1 cut(s) 638
XspI CTAG 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.