Basic Information

Type: gene

Biological Identity

Species

rosa_wichuraiana

Chromosome

Chr5

Orthogroup ID

OG0007904

Physical Location & Seq

Genomic Coordinates Reverse (-)

41039281 .. 41045801

Gene Structure 6521 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rw5G027660.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 282 bp

ATGGAATGGCAAGAACTCTATCAGAAAGGAATTGGGGTGACCATTGTTTGTCCTGGTCCAATAGAAACATCAAATGGTACAGGAGCAGCAAGCTCAGAGAATAAAGCTTCTTCTGAGAAGCGTGTGTCATCAGAAAGGTGTGCAGAGTTGACAATAATTGCTGCCACCCATGGTCTAAAGGAAGTTTGGATATCATACCAGTTTATGGTAGTGCTGAATAATATCTTTCTTTGTATTAATCTAACCTACCAATCCAATTTTATAAAAGAATATGGTTACTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

adh_short

Protein Analysis

93

Amino Acids

10.37

Weight (kDa)

5.28

Isoelectric Point (pI)

29.87

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007904)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G03330
fragaria_vesca	FvH4_6g00210 FvH4_6g00210 FvH4_6g00210 FvH4_6g00210
malus_domestica	MD04G1247200.v1.1
prunus_persica	Prupe.6G363500_v2.0.a1 Prupe.6G363500_v2.0.a1 Prupe.6G363500_v2.0.a1
pyrus_communis	pycom04g21790
rosa_chinensis	RchiOBHm_Chr3g0447581
rosa_laevigata	RLG00000025987
rosa_multiflora	Rmu_sc0003550.1_g000006 Rmu_sc0026794.1_g000002
rosa_roxburghii	Rroxscaffold_1G00009020 Rroxscaffold_6G00425790
rosa_rugosa	Rorug02G0603200
rosa_samantha	Rh3AG003400 Rh3BG002900 Rh3CG003200 Rh3DG003200 Rh7AG458400
rosa_wichuraiana	Rw3G000230 Rw5G027660

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	263
AccB7I	CCANNNNNTGG	1 cut(s)	205
AfaI	GTAC	1 cut(s)	79
AfiI	CCNNNNNNNGG	1 cut(s)	205
AjnI	CCWGG	1 cut(s)	52
AluBI	AGCT	2 cut(s)	93, 107
AluI	AGCT	2 cut(s)	93, 107
ApeKI	GCWGC	2 cut(s)	86, 161
AseI	ATTAAT	1 cut(s)	237
AspS9I	GGNCC	1 cut(s)	56
AsuHPI	GGTGA	1 cut(s)	49
AvaII	GGWCC	1 cut(s)	56
BbvI	GCAGC	2 cut(s)	98, 148
BciT130I	CCWGG	1 cut(s)	54
BisI	GCNGC	2 cut(s)	87, 162
BlsI	GCNGC	2 cut(s)	88, 163
Bme1390I	CCNGG	1 cut(s)	54
Bme18I	GGWCC	1 cut(s)	56
BmgT120I	GGNCC	1 cut(s)	56
BmrFI	CCNGG	1 cut(s)	54
BsaJI	CCNNGG	1 cut(s)	169
Bsc4I	CCNNNNNNNGG	1 cut(s)	205
Bse1I	ACTGG	1 cut(s)	199
BseBI	CCWGG	1 cut(s)	54
BseDI	CCNNGG	1 cut(s)	169
BseLI	CCNNNNNNNGG	1 cut(s)	205
BseMII	CTCAG	2 cut(s)	105, 108
BseNI	ACTGG	1 cut(s)	199
BseXI	GCAGC	2 cut(s)	98, 148
BsgI	GTGCAG	1 cut(s)	162
BslI	CCNNNNNNNGG	1 cut(s)	205
Bsp19I	CCATGG	1 cut(s)	169
BspCNI	CTCAG	2 cut(s)	106, 107
BsrI	ACTGG	1 cut(s)	199
BssECI	CCNNGG	1 cut(s)	169
BssT1I	CCWWGG	1 cut(s)	169
Bst2UI	CCWGG	1 cut(s)	54
BstC8I	GCNNGC	1 cut(s)	91
BstDEI	CTNAG	2 cut(s)	94, 114
BstDSI	CCRYGG	1 cut(s)	169
BstEII	GGTNACC	1 cut(s)	37
BstNI	CCWGG	1 cut(s)	54
BstPI	GGTNACC	1 cut(s)	37
BstSCI	CCNGG	1 cut(s)	52
BstV1I	GCAGC	2 cut(s)	98, 148
BtgI	CCRYGG	1 cut(s)	169
Cac8I	GCNNGC	1 cut(s)	91
Cfr13I	GGNCC	1 cut(s)	56
Csp6I	GTAC	1 cut(s)	78
CviAII	CATG	1 cut(s)	170
CviJI	RGCY	2 cut(s)	93, 107
CviKI_1	RGCY	2 cut(s)	93, 107
CviQI	GTAC	1 cut(s)	78
DdeI	CTNAG	2 cut(s)	94, 114
Eco130I	CCWWGG	1 cut(s)	169
Eco32I	GATATC	1 cut(s)	192
Eco47I	GGWCC	1 cut(s)	56
Eco91I	GGTNACC	1 cut(s)	37
EcoO65I	GGTNACC	1 cut(s)	37
EcoRII	CCWGG	1 cut(s)	52
EcoRV	GATATC	1 cut(s)	192
EcoT14I	CCWWGG	1 cut(s)	169
ErhI	CCWWGG	1 cut(s)	169
FaeI	CATG	1 cut(s)	173
FaiI	YATR	5 cut(s)	171, 196, 206, 263, 273
FatI	CATG	1 cut(s)	169
Fnu4HI	GCNGC	2 cut(s)	87, 162
Fsp4HI	GCNGC	2 cut(s)	87, 162
GluI	GCNGC	2 cut(s)	87, 162
Hin1II	CATG	1 cut(s)	173
HincII	GTYRAC	1 cut(s)	150
HindII	GTYRAC	1 cut(s)	150
HindIII	AAGCTT	1 cut(s)	105
HphI	GGTGA	1 cut(s)	49
Hpy166II	GTNNAC	1 cut(s)	150
Hpy188I	TCNGA	4 cut(s)	24, 97, 115, 133
Hpy8I	GTNNAC	1 cut(s)	150
HpyCH4V	TGCA	1 cut(s)	143
HpyF3I	CTNAG	2 cut(s)	94, 114
Hsp92II	CATG	1 cut(s)	173
LmnI	GCTCC	1 cut(s)	83
LpnPI	CCDG	4 cut(s)	39, 66, 66, 212
Lsp1109I	GCAGC	2 cut(s)	98, 148
MaeIII	GTNAC	2 cut(s)	37, 275
MboII	GAAGA	1 cut(s)	102
MluCI	AATT	3 cut(s)	30, 156, 256
MseI	TTAA	1 cut(s)	237
MspR9I	CCNGG	1 cut(s)	54
MvaI	CCWGG	1 cut(s)	54
NcoI	CCATGG	1 cut(s)	169
NlaIII	CATG	1 cut(s)	173
NmuCI	GTSAC	1 cut(s)	37
PflMI	CCANNNNNTGG	1 cut(s)	205
PkrI	GCNGC	2 cut(s)	88, 163
PshBI	ATTAAT	1 cut(s)	237
PsiI	TTATAA	1 cut(s)	263
Psp6I	CCWGG	1 cut(s)	52
PspEI	GGTNACC	1 cut(s)	37
PspGI	CCWGG	1 cut(s)	52
PspPI	GGNCC	1 cut(s)	56
RsaI	GTAC	1 cut(s)	79
RsaNI	GTAC	1 cut(s)	78
SaqAI	TTAA	1 cut(s)	237
SatI	GCNGC	2 cut(s)	87, 162
Sau96I	GGNCC	1 cut(s)	56
ScrFI	CCNGG	1 cut(s)	54
SetI	ASST	4 cut(s)	95, 109, 140, 248
SgeI	CNNG	8 cut(s)	23, 65, 66, 93, 102, 134, 182, 211
SinI	GGWCC	1 cut(s)	56
Sse9I	AATT	3 cut(s)	30, 156, 256
StyD4I	CCNGG	1 cut(s)	52
StyI	CCWWGG	1 cut(s)	169
TasI	AATT	3 cut(s)	30, 156, 256
Tru1I	TTAA	1 cut(s)	237
Tru9I	TTAA	1 cut(s)	237
TseFI	GTSAC	1 cut(s)	37
TseI	GCWGC	2 cut(s)	86, 161
Tsp45I	GTSAC	1 cut(s)	37
Van91I	CCANNNNNTGG	1 cut(s)	205
VpaK11BI	GGWCC	1 cut(s)	56
VspI	ATTAAT	1 cut(s)	237

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.