AT1G06515

Small subunit of serine palmitoyltransferase-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
OG0015141
Physical Location & Seq
Reverse (-)
1990634 .. 1992228
1595 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G06515.1

Sequence Viewer

Length: 171 bp
ATGAACTGGGTTCAACGCAAAATCTACCTTTATAATGTCACATTCGGGCTCTACATGCTTGATTGGTGGGAACGATACCTCTTCAATTCTTTGGTGGTTGTTTTGATGTGGTTCGTTTTATACAACGGTACTCGCTACTTTTCGGAGCTTTTCCAGAGGCATTTGACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
SPT_ssu-like

Protein Analysis

56

Amino Acids

7.17

Weight (kDa)

9.22

Isoelectric Point (pI)

13.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SPT_ssu-like PF11779 1 - 52 9.8e-23 Small subunit of serine palmitoyltransferase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015141)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G06515 AT1G06515 AT2G30942
fragaria_vesca FvH4_3g38980
malus_domestica MD03G1065900.v1.1 MD11G1070700.v1.1 MD12G1007100.v1.1
prunus_persica Prupe.6G054600_v2.0.a1
rosa_chinensis RchiOBHm_Chr5g0070251 RchiOBHm_Chr7g0176991
rosa_rugosa Rorug05G0404400 Rorug05G0404500 Rorug05G0404600
rosa_samantha Rh7AG002200
rosa_wichuraiana Rw5G042900 Rw7G000170

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 33
AfaI GTAC 1 cut(s) 130
AgsI TTSAA 2 cut(s) 14, 85
AluBI AGCT 1 cut(s) 148
AluI AGCT 1 cut(s) 148
BanII GRGCYC 1 cut(s) 51
BmrI ACTGGG 1 cut(s) 16
BmuI ACTGGG 1 cut(s) 16
Bse1I ACTGG 1 cut(s) 11
BseNI ACTGG 1 cut(s) 11
Bsp1286I GDGCHC 1 cut(s) 51
BsrI ACTGG 1 cut(s) 11
Bst4CI ACNGT 1 cut(s) 128
Bst6I CTCTTC 1 cut(s) 86
BstMWI GCNNNNNNNGC 1 cut(s) 55
BstNSI RCATGY 1 cut(s) 58
Csp6I GTAC 1 cut(s) 129
CviAII CATG 2 cut(s) 55, 168
CviJI RGCY 2 cut(s) 49, 148
CviKI_1 RGCY 2 cut(s) 49, 148
CviQI GTAC 1 cut(s) 129
Eam1104I CTCTTC 1 cut(s) 86
EarI CTCTTC 1 cut(s) 86
Eco24I GRGCYC 1 cut(s) 51
EcoT38I GRGCYC 1 cut(s) 51
FaeI CATG 2 cut(s) 58, 171
FaiI YATR 4 cut(s) 33, 56, 121, 169
FatI CATG 2 cut(s) 54, 167
FriOI GRGCYC 1 cut(s) 51
Hin1II CATG 2 cut(s) 58, 171
Hpy188I TCNGA 1 cut(s) 145
Hpy188III TCNNGA 1 cut(s) 154
HpyCH4III ACNGT 1 cut(s) 128
HpyF10VI GCNNNNNNNGC 1 cut(s) 55
Hsp92II CATG 2 cut(s) 58, 171
LmnI GCTCC 1 cut(s) 145
LpnPI CCDG 1 cut(s) 167
MaeIII GTNAC 1 cut(s) 37
MboII GAAGA 1 cut(s) 73
MhlI GDGCHC 1 cut(s) 51
MluCI AATT 1 cut(s) 85
MnlI CCTC 2 cut(s) 89, 150
MwoI GCNNNNNNNGC 1 cut(s) 55
NlaIII CATG 2 cut(s) 58, 171
NmuCI GTSAC 1 cut(s) 37
NspI RCATGY 1 cut(s) 58
PsiI TTATAA 1 cut(s) 33
RsaI GTAC 1 cut(s) 130
RsaNI GTAC 1 cut(s) 129
SduI GDGCHC 1 cut(s) 51
SetI ASST 3 cut(s) 30, 81, 150
SgeI CNNG 6 cut(s) 19, 58, 67, 71, 144, 166
Sse9I AATT 1 cut(s) 85
TaaI ACNGT 1 cut(s) 128
TasI AATT 1 cut(s) 85
TseFI GTSAC 1 cut(s) 37
Tsp45I GTSAC 1 cut(s) 37
TspDTI ATGAA 1 cut(s) 17
XceI RCATGY 1 cut(s) 58
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.