Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0015141

Physical Location & Seq

Genomic Coordinates Forward (+)

158428 .. 161006

Gene Structure 2579 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ15764

Sequence Viewer

CDS Protein Promoter (2k)

Length: 171 bp

ATGAATTGGGTTCAACGTAAGATCTATCTATACAATGTCACTTTTGGGCTCTATATGTTGGATTGGTGGGAGCGTTATCTTTTCAATACGTTGGTCCTGGTGTTGATGTGGTTCATCTTTTACAATAGCTCGCGGTATTTAACAGAATTTTGCAAGAGGCATCTATGGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

SPT_ssu-like

Protein Analysis

56

Amino Acids

7.31

Weight (kDa)

9.3

Isoelectric Point (pI)

38.89

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
SPT_ssu-like	PF11779	1 - 51	4.3e-22	Small subunit of serine palmitoyltransferase-like

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015141)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G06515 AT1G06515 AT2G30942
fragaria_vesca	FvH4_3g38980
malus_domestica	MD03G1065900.v1.1 MD11G1070700.v1.1 MD12G1007100.v1.1
prunus_persica	Prupe.6G054600_v2.0.a1
rosa_chinensis	RchiOBHm_Chr5g0070251 RchiOBHm_Chr7g0176991
rosa_rugosa	Rorug05G0404400 Rorug05G0404500 Rorug05G0404600
rosa_samantha	Rh7AG002200
rosa_wichuraiana	Rw5G042900 Rw7G000170

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	133
AciI	CCGC	1 cut(s)	133
AcsI	RAATTY	1 cut(s)	146
AgsI	TTSAA	2 cut(s)	14, 85
AjnI	CCWGG	1 cut(s)	96
AluBI	AGCT	1 cut(s)	129
AluI	AGCT	1 cut(s)	129
ApoI	RAATTY	1 cut(s)	146
AspS9I	GGNCC	1 cut(s)	94
AvaII	GGWCC	1 cut(s)	94
BanII	GRGCYC	1 cut(s)	51
BciT130I	CCWGG	1 cut(s)	98
BglII	AGATCT	1 cut(s)	21
Bme1390I	CCNGG	1 cut(s)	98
Bme18I	GGWCC	1 cut(s)	94
BmgT120I	GGNCC	1 cut(s)	94
BmrFI	CCNGG	1 cut(s)	98
BseBI	CCWGG	1 cut(s)	98
Bsh1236I	CGCG	1 cut(s)	133
Bsp1286I	GDGCHC	1 cut(s)	51
Bsp143I	GATC	1 cut(s)	21
BspACI	CCGC	1 cut(s)	133
BspFNI	CGCG	1 cut(s)	133
BssMI	GATC	1 cut(s)	21
Bst2UI	CCWGG	1 cut(s)	98
BstC8I	GCNNGC	1 cut(s)	131
BstFNI	CGCG	1 cut(s)	133
BstKTI	GATC	1 cut(s)	24
BstMBI	GATC	1 cut(s)	21
BstNI	CCWGG	1 cut(s)	98
BstSCI	CCNGG	1 cut(s)	96
BstUI	CGCG	1 cut(s)	133
BstX2I	RGATCY	1 cut(s)	21
BstYI	RGATCY	1 cut(s)	21
Cac8I	GCNNGC	1 cut(s)	131
Cfr13I	GGNCC	1 cut(s)	94
CviJI	RGCY	2 cut(s)	49, 129
CviKI_1	RGCY	2 cut(s)	49, 129
DpnI	GATC	1 cut(s)	23
DpnII	GATC	1 cut(s)	21
Eco24I	GRGCYC	1 cut(s)	51
Eco47I	GGWCC	1 cut(s)	94
EcoRII	CCWGG	1 cut(s)	96
EcoT38I	GRGCYC	1 cut(s)	51
FaiI	YATR	4 cut(s)	31, 54, 56, 166
FriOI	GRGCYC	1 cut(s)	51
HpyCH4IV	ACGT	2 cut(s)	16, 89
HpyCH4V	TGCA	1 cut(s)	153
HpySE526I	ACGT	2 cut(s)	16, 89
Kzo9I	GATC	1 cut(s)	21
LmnI	GCTCC	1 cut(s)	70
LpnPI	CCDG	2 cut(s)	83, 110
MaeII	ACGT	2 cut(s)	16, 89
MaeIII	GTNAC	1 cut(s)	37
MalI	GATC	1 cut(s)	23
MboI	GATC	1 cut(s)	21
MflI	RGATCY	1 cut(s)	21
MhlI	GDGCHC	1 cut(s)	51
MluCI	AATT	2 cut(s)	4, 146
MmeI	TCCRAC	1 cut(s)	39
MnlI	CCTC	1 cut(s)	150
MseI	TTAA	1 cut(s)	140
MspR9I	CCNGG	1 cut(s)	98
MvaI	CCWGG	1 cut(s)	98
MvnI	CGCG	1 cut(s)	133
NdeII	GATC	1 cut(s)	21
NmuCI	GTSAC	1 cut(s)	37
Psp6I	CCWGG	1 cut(s)	96
PspGI	CCWGG	1 cut(s)	96
PspPI	GGNCC	1 cut(s)	94
PsuI	RGATCY	1 cut(s)	21
SaqAI	TTAA	1 cut(s)	140
Sau3AI	GATC	1 cut(s)	21
Sau96I	GGNCC	1 cut(s)	94
ScrFI	CCNGG	1 cut(s)	98
SduI	GDGCHC	1 cut(s)	51
SetI	ASST	3 cut(s)	19, 92, 131
SgeI	CNNG	5 cut(s)	109, 110, 142, 144, 166
SinI	GGWCC	1 cut(s)	94
Sse9I	AATT	2 cut(s)	4, 146
SsiI	CCGC	1 cut(s)	133
StyD4I	CCNGG	1 cut(s)	96
TaiI	ACGT	2 cut(s)	19, 92
TasI	AATT	2 cut(s)	4, 146
Tru1I	TTAA	1 cut(s)	140
Tru9I	TTAA	1 cut(s)	140
TseFI	GTSAC	1 cut(s)	37
Tsp45I	GTSAC	1 cut(s)	37
TspDTI	ATGAA	2 cut(s)	17, 103
VpaK11BI	GGWCC	1 cut(s)	94
XapI	RAATTY	1 cut(s)	146

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.