Rw7G000170

Small subunit of serine palmitoyltransferase-like

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr7
Physical Location & Seq
Forward (+)
198233 .. 199598
1366 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw7G000170.1

Sequence Viewer

Length: 186 bp
ATGTGTCCTGGAGCCATGAATTGGGTTCAACGTAAGATCTATCTGTACAATGTCACTTTTGGGCTCTATATGTTGGATTGGTGGGAGCGTTATCTTTTCAATACGTTGGTCCTGGTGTTGATGTGGTTCATCTTTTACAATAGCTCGCGGTATTTAACAGAATTTTGCAAGAGGCATCTATGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

61

Amino Acids

7.77

Weight (kDa)

9.1

Isoelectric Point (pI)

38.29

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SPT_ssu-like PF11779 6 - 56 5.9e-22 Small subunit of serine palmitoyltransferase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015141)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 21
AccII CGCG 1 cut(s) 148
AciI CCGC 1 cut(s) 148
AcsI RAATTY 1 cut(s) 161
AfaI GTAC 1 cut(s) 47
AfiI CCNNNNNNNGG 1 cut(s) 21
AgsI TTSAA 2 cut(s) 29, 100
AjnI CCWGG 2 cut(s) 7, 111
AluBI AGCT 1 cut(s) 144
AluI AGCT 1 cut(s) 144
ApoI RAATTY 1 cut(s) 161
AspS9I GGNCC 1 cut(s) 109
AvaII GGWCC 1 cut(s) 109
BanII GRGCYC 1 cut(s) 66
BciT130I CCWGG 2 cut(s) 9, 113
BglII AGATCT 1 cut(s) 36
Bme1390I CCNGG 2 cut(s) 9, 113
Bme18I GGWCC 1 cut(s) 109
BmgT120I GGNCC 1 cut(s) 109
BmiI GGNNCC 1 cut(s) 13
BmrFI CCNGG 2 cut(s) 9, 113
BpmI CTGGAG 1 cut(s) 30
Bsc4I CCNNNNNNNGG 1 cut(s) 21
BseBI CCWGG 2 cut(s) 9, 113
BseLI CCNNNNNNNGG 1 cut(s) 21
Bsh1236I CGCG 1 cut(s) 148
BslI CCNNNNNNNGG 1 cut(s) 21
Bsp1286I GDGCHC 1 cut(s) 66
Bsp1407I TGTACA 1 cut(s) 45
Bsp143I GATC 1 cut(s) 36
BspACI CCGC 1 cut(s) 148
BspFNI CGCG 1 cut(s) 148
BspLI GGNNCC 1 cut(s) 13
BsrGI TGTACA 1 cut(s) 45
BssMI GATC 1 cut(s) 36
Bst2UI CCWGG 2 cut(s) 9, 113
BstAUI TGTACA 1 cut(s) 45
BstC8I GCNNGC 1 cut(s) 146
BstFNI CGCG 1 cut(s) 148
BstKTI GATC 1 cut(s) 39
BstMBI GATC 1 cut(s) 36
BstNI CCWGG 2 cut(s) 9, 113
BstSCI CCNGG 2 cut(s) 7, 111
BstUI CGCG 1 cut(s) 148
BstX2I RGATCY 1 cut(s) 36
BstYI RGATCY 1 cut(s) 36
Cac8I GCNNGC 1 cut(s) 146
Cfr13I GGNCC 1 cut(s) 109
Csp6I GTAC 1 cut(s) 46
CviAII CATG 1 cut(s) 16
CviJI RGCY 3 cut(s) 14, 64, 144
CviKI_1 RGCY 3 cut(s) 14, 64, 144
CviQI GTAC 1 cut(s) 46
DpnI GATC 1 cut(s) 38
DpnII GATC 1 cut(s) 36
Eco24I GRGCYC 1 cut(s) 66
Eco47I GGWCC 1 cut(s) 109
EcoRII CCWGG 2 cut(s) 7, 111
EcoT38I GRGCYC 1 cut(s) 66
FaeI CATG 1 cut(s) 19
FaiI YATR 4 cut(s) 17, 69, 71, 181
FatI CATG 1 cut(s) 15
FriOI GRGCYC 1 cut(s) 66
GsuI CTGGAG 1 cut(s) 30
Hin1II CATG 1 cut(s) 19
HpyCH4IV ACGT 2 cut(s) 31, 104
HpyCH4V TGCA 1 cut(s) 168
HpySE526I ACGT 2 cut(s) 31, 104
Hsp92II CATG 1 cut(s) 19
Kzo9I GATC 1 cut(s) 36
LmnI GCTCC 2 cut(s) 11, 85
LpnPI CCDG 3 cut(s) 21, 98, 125
MaeII ACGT 2 cut(s) 31, 104
MaeIII GTNAC 1 cut(s) 52
MalI GATC 1 cut(s) 38
MboI GATC 1 cut(s) 36
MflI RGATCY 1 cut(s) 36
MhlI GDGCHC 1 cut(s) 66
MluCI AATT 2 cut(s) 19, 161
MmeI TCCRAC 1 cut(s) 54
MnlI CCTC 1 cut(s) 165
MseI TTAA 1 cut(s) 155
MspR9I CCNGG 2 cut(s) 9, 113
MvaI CCWGG 2 cut(s) 9, 113
MvnI CGCG 1 cut(s) 148
NdeII GATC 1 cut(s) 36
NlaIII CATG 1 cut(s) 19
NlaIV GGNNCC 1 cut(s) 13
NmuCI GTSAC 1 cut(s) 52
PflMI CCANNNNNTGG 1 cut(s) 21
PfoI TCCNGGA 1 cut(s) 7
Psp6I CCWGG 2 cut(s) 7, 111
PspGI CCWGG 2 cut(s) 7, 111
PspN4I GGNNCC 1 cut(s) 13
PspPI GGNCC 1 cut(s) 109
PsuI RGATCY 1 cut(s) 36
RsaI GTAC 1 cut(s) 47
RsaNI GTAC 1 cut(s) 46
SaqAI TTAA 1 cut(s) 155
Sau3AI GATC 1 cut(s) 36
Sau96I GGNCC 1 cut(s) 109
ScrFI CCNGG 2 cut(s) 9, 113
SduI GDGCHC 1 cut(s) 66
SetI ASST 3 cut(s) 34, 107, 146
SgeI CNNG 8 cut(s) 20, 21, 28, 124, 125, 157, 159, 181
SinI GGWCC 1 cut(s) 109
Sse9I AATT 2 cut(s) 19, 161
SsiI CCGC 1 cut(s) 148
StyD4I CCNGG 2 cut(s) 7, 111
TaiI ACGT 2 cut(s) 34, 107
TasI AATT 2 cut(s) 19, 161
TatI WGTACW 1 cut(s) 45
Tru1I TTAA 1 cut(s) 155
Tru9I TTAA 1 cut(s) 155
TseFI GTSAC 1 cut(s) 52
Tsp45I GTSAC 1 cut(s) 52
TspDTI ATGAA 2 cut(s) 32, 118
Van91I CCANNNNNTGG 1 cut(s) 21
VpaK11BI GGWCC 1 cut(s) 109
XapI RAATTY 1 cut(s) 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.