AT1G37010

Gamma-tubulin complex is necessary for microtubule nucleation at the centrosome

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
Physical Location & Seq
Forward (+)
14040918 .. 14041227
310 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G37010.1

Sequence Viewer

Length: 264 bp
ATGGAGCTAGGCTGTGAATGGTACTTGGAAATATCTCAACAAATTTTGGATATCATCTTTGGGATACAAACGAGTGGAAGAGATCATATGGGTAAAGACGAATCAACTTCCACTCATTTGGGGATAAGTGATAATGGTAATGGGCTTTTAAGCCGTGGAATAGTTAAGAAGAAGGATTGGAGTAATGGAGTTTTGTTGGTTAGTAAAGATCCTGAGAATTTGAGGGATATTGCGTTTAGACAGTATGCGATTTTGGTTAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

9.76

Weight (kDa)

5.56

Isoelectric Point (pI)

19.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 203
AcsI RAATTY 2 cut(s) 42, 217
AfaI GTAC 1 cut(s) 23
AluBI AGCT 1 cut(s) 7
AluI AGCT 1 cut(s) 7
AlwI GGATC 1 cut(s) 203
ApoI RAATTY 2 cut(s) 42, 217
BceAI ACGGC 1 cut(s) 138
BciVI GTATCC 1 cut(s) 57
BfaI CTAG 1 cut(s) 8
BfuI GTATCC 1 cut(s) 57
BsaJI CCNNGG 1 cut(s) 154
BseDI CCNNGG 1 cut(s) 154
BseMII CTCAG 1 cut(s) 204
Bsp143I GATC 2 cut(s) 82, 208
BspCNI CTCAG 1 cut(s) 205
BspPI GGATC 1 cut(s) 203
BssECI CCNNGG 1 cut(s) 154
BssMI GATC 2 cut(s) 82, 208
Bst4CI ACNGT 1 cut(s) 243
Bst6I CTCTTC 1 cut(s) 73
BstDEI CTNAG 1 cut(s) 213
BstDSI CCRYGG 1 cut(s) 154
BstKTI GATC 2 cut(s) 85, 211
BstMBI GATC 2 cut(s) 82, 208
BstX2I RGATCY 1 cut(s) 208
BstXI CCANNNNNNTGG 1 cut(s) 118
BstYI RGATCY 1 cut(s) 208
BsuI GTATCC 1 cut(s) 57
BtgI CCRYGG 1 cut(s) 154
Csp6I GTAC 1 cut(s) 22
CviJI RGCY 4 cut(s) 7, 12, 145, 153
CviKI_1 RGCY 4 cut(s) 7, 12, 145, 153
CviQI GTAC 1 cut(s) 22
DdeI CTNAG 1 cut(s) 213
DpnI GATC 2 cut(s) 84, 210
DpnII GATC 2 cut(s) 82, 208
Eam1104I CTCTTC 1 cut(s) 73
EarI CTCTTC 1 cut(s) 73
Eco32I GATATC 1 cut(s) 52
EcoRV GATATC 1 cut(s) 52
FaiI YATR 3 cut(s) 87, 89, 246
FauNDI CATATG 1 cut(s) 87
FspBI CTAG 1 cut(s) 8
HinfI GANTC 1 cut(s) 101
Hpy188III TCNNGA 1 cut(s) 212
HpyAV CCTTC 1 cut(s) 166
HpyCH4III ACNGT 1 cut(s) 243
HpyF3I CTNAG 1 cut(s) 213
Kzo9I GATC 2 cut(s) 82, 208
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 1 cut(s) 225
MaeI CTAG 1 cut(s) 8
MalI GATC 2 cut(s) 84, 210
MboI GATC 2 cut(s) 82, 208
MboII GAAGA 2 cut(s) 90, 181
MflI RGATCY 1 cut(s) 208
MluCI AATT 2 cut(s) 42, 217
MnlI CCTC 1 cut(s) 216
MseI TTAA 3 cut(s) 149, 165, 258
NdeI CATATG 1 cut(s) 87
NdeII GATC 2 cut(s) 82, 208
PfeI GAWTC 1 cut(s) 101
PsuI RGATCY 1 cut(s) 208
RsaI GTAC 1 cut(s) 23
RsaNI GTAC 1 cut(s) 22
SaqAI TTAA 3 cut(s) 149, 165, 258
Sau3AI GATC 2 cut(s) 82, 208
SetI ASST 1 cut(s) 9
SgeI CNNG 5 cut(s) 20, 37, 84, 167, 224
Sse9I AATT 2 cut(s) 42, 217
SspMI CTAG 1 cut(s) 8
TaaI ACNGT 1 cut(s) 243
TasI AATT 2 cut(s) 42, 217
TfiI GAWTC 1 cut(s) 101
Tru1I TTAA 3 cut(s) 149, 165, 258
Tru9I TTAA 3 cut(s) 149, 165, 258
XapI RAATTY 2 cut(s) 42, 217
XspI CTAG 1 cut(s) 8
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.