AT2G10553

zinc finger

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
Physical Location & Seq
Reverse (-)
4100335 .. 4101084
750 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G10553.1

Sequence Viewer

Length: 249 bp
ATGCGGGCGTTTAAGTTTGCTTTAGTTGAGGTTGTAAAAGATCTTTTAAAACCAGCTTGGAAAGAAGGTAAGCTTAACAAAGATGGTTACAAAAACATAGTGAAGAAGGTAGCTGAGAAAGTGACTGGTACAATGCAAAGTGGAAACGTTCCTCAAACACAGGAGAAGATTGACCATTATCTATCCGCTTCGAAACCAAAGCTTACCAAGCTCGTTCAGGCATACGTCGGCAAAATCAAGAAGACCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

82

Amino Acids

9.23

Weight (kDa)

10.0

Isoelectric Point (pI)

12.47

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SCAF11-like_C PF23030 8 - 62 1e-07 SCAF11-like, C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 4, 186
AclI AACGTT 1 cut(s) 147
AfaI GTAC 1 cut(s) 130
AluBI AGCT 5 cut(s) 56, 73, 113, 202, 211
AluI AGCT 5 cut(s) 56, 73, 113, 202, 211
AsuII TTCGAA 1 cut(s) 191
BccI CCATC 1 cut(s) 77
BglII AGATCT 1 cut(s) 40
Bpu14I TTCGAA 1 cut(s) 191
Bse1I ACTGG 1 cut(s) 130
BseMII CTCAG 1 cut(s) 105
BseNI ACTGG 1 cut(s) 130
Bsp119I TTCGAA 1 cut(s) 191
Bsp143I GATC 1 cut(s) 40
BspACI CCGC 2 cut(s) 4, 186
BspCNI CTCAG 1 cut(s) 106
BspT104I TTCGAA 1 cut(s) 191
BsrI ACTGG 1 cut(s) 130
BssMI GATC 1 cut(s) 40
BstBI TTCGAA 1 cut(s) 191
BstC8I GCNNGC 1 cut(s) 6
BstDEI CTNAG 1 cut(s) 114
BstKTI GATC 1 cut(s) 43
BstMBI GATC 1 cut(s) 40
BstMWI GCNNNNNNNGC 1 cut(s) 208
BstX2I RGATCY 1 cut(s) 40
BstYI RGATCY 1 cut(s) 40
Cac8I GCNNGC 1 cut(s) 6
Csp6I GTAC 1 cut(s) 129
CviJI RGCY 5 cut(s) 56, 73, 113, 202, 211
CviKI_1 RGCY 5 cut(s) 56, 73, 113, 202, 211
CviQI GTAC 1 cut(s) 129
DdeI CTNAG 1 cut(s) 114
DpnI GATC 1 cut(s) 42
DpnII GATC 1 cut(s) 40
DraI TTTAAA 1 cut(s) 48
FaiI YATR 2 cut(s) 98, 223
FalI AAGNNNNNCTT 2 cut(s) 57, 89
HindIII AAGCTT 2 cut(s) 71, 200
Hpy188III TCNNGA 1 cut(s) 238
Hpy99I CGWCG 1 cut(s) 230
HpyAV CCTTC 2 cut(s) 59, 100
HpyCH4IV ACGT 2 cut(s) 147, 225
HpyCH4V TGCA 1 cut(s) 136
HpyF10VI GCNNNNNNNGC 1 cut(s) 208
HpyF3I CTNAG 1 cut(s) 114
HpySE526I ACGT 2 cut(s) 147, 225
Kzo9I GATC 1 cut(s) 40
LpnPI CCDG 4 cut(s) 66, 111, 146, 203
MaeII ACGT 2 cut(s) 147, 225
MaeIII GTNAC 2 cut(s) 86, 121
MalI GATC 1 cut(s) 42
MboI GATC 1 cut(s) 40
MboII GAAGA 2 cut(s) 115, 178
MflI RGATCY 1 cut(s) 40
MnlI CCTC 2 cut(s) 22, 162
MseI TTAA 3 cut(s) 12, 47, 75
MwoI GCNNNNNNNGC 1 cut(s) 208
NdeII GATC 1 cut(s) 40
NmuCI GTSAC 1 cut(s) 121
NspV TTCGAA 1 cut(s) 191
Psp1406I AACGTT 1 cut(s) 147
PsuI RGATCY 1 cut(s) 40
RsaI GTAC 1 cut(s) 130
RsaNI GTAC 1 cut(s) 129
SaqAI TTAA 3 cut(s) 12, 47, 75
Sau3AI GATC 1 cut(s) 40
SfuI TTCGAA 1 cut(s) 191
SgeI CNNG 8 cut(s) 17, 65, 69, 138, 173, 220, 224, 230
SsiI CCGC 2 cut(s) 4, 186
TaiI ACGT 2 cut(s) 150, 228
TaqI TCGA 1 cut(s) 191
Tru1I TTAA 3 cut(s) 12, 47, 75
Tru9I TTAA 3 cut(s) 12, 47, 75
TseFI GTSAC 1 cut(s) 121
Tsp45I GTSAC 1 cut(s) 121
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.