Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005045.1

Orthogroup ID

OG0005393

Physical Location & Seq

Genomic Coordinates Reverse (-)

169340 .. 170552

Gene Structure 1213 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005045.1_g000049.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 699 bp

atgagtagaagcagcaggaaacgctcttctaaatgggatttgcctgaagagcctcaatttgaagatgcaaatataccagatgatggttggatgggaaaagcgggtaggccatttcatcataaagaatctggacgtgagtggcactctccagagcttggtggtagtaatgcttcaaaatggtcaggtttagagacgaatgatatgcagagatctaagcgtggtttaggattgccatccagggaagctttgcctggaagcagaagctcacataggaatgaaagtatcagtaagggcggcagcagatacacagaagactccatggtctgggatgaagatggaaattgcagcacaaggatgtctcctggtcttgatgagtggagacaacatcgtagtcggtcccccaaaagtggggtaggagtagaagtagaagctggaccaggagtagaagccagagctggagcaggagtccagatcatggctataggcgagaatcagtcgagggtaggagtagaagtagaagctggaccaggagtagaagccagagctggagcaggagtccagatcgtggctataggcgagaatcagttttccttgatagaaatagaagcagatcgggagtttcagctcaagtgtgcaaagattttgctggtggaagatgcaggagaggaagtgattgtcagttactacatgaggaagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

zf-CCCH

Protein Analysis

232

Amino Acids

25.4

Weight (kDa)

5.53

Isoelectric Point (pI)

66.49

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005393)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G10553 AT3G18640 AT3G18640 AT3G18640
fragaria_vesca	FvH4_1g24100 FvH4_1g24100 FvH4_1g24100 FvH4_1g24100
malus_domestica	MD01G1013400.v1.1 MD15G1337600.v1.1
prunus_persica	Prupe.6G159100_v2.0.a1 Prupe.6G159100_v2.0.a1 Prupe.6G159100_v2.0.a1
pyrus_communis	pycom01g04540 pycom15g28880
rosa_chinensis	RchiOBHm_Chr2g0120281
rosa_laevigata	RLG00000018547
rosa_multiflora	Rmu_sc0004523.1_g000007 Rmu_sc0005045.1_g000049
rosa_roxburghii	Rroxscaffold_2G00123570
rosa_rugosa	Rorug02G0228100 Rorug02G0228200 Rorug02G0228300 Rorug02G0228400
rosa_samantha	Rh2AG284700 Rh2BG295700 Rh2CG273300 Rh2DG309700
rosa_wichuraiana	Rw2G022830

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	320
AccB7I	CCANNNNNTGG	5 cut(s)	83, 155, 324, 475, 565
AciI	CCGC	2 cut(s)	101, 294
AcuI	CTGAAG	1 cut(s)	66
AfiI	CCNNNNNNNGG	7 cut(s)	83, 155, 324, 407, 408, 475, 565
AgsI	TTSAA	2 cut(s)	62, 174
AjiI	CACGTC	1 cut(s)	134
AjnI	CCWGG	5 cut(s)	236, 250, 361, 436, 526
AluBI	AGCT	8 cut(s)	154, 245, 264, 431, 455, 521, 545, 625
AluI	AGCT	8 cut(s)	154, 245, 264, 431, 455, 521, 545, 625
Alw26I	GTCTC	3 cut(s)	185, 363, 373
AoxI	GGCC	1 cut(s)	107
ApeKI	GCWGC	3 cut(s)	12, 297, 345
AspS9I	GGNCC	3 cut(s)	396, 434, 524
AvaII	GGWCC	3 cut(s)	396, 434, 524
BarI	GAAGNNNNNNTAC	2 cut(s)	154, 186
BbsI	GAAGAC	1 cut(s)	318
BbvI	GCAGC	3 cut(s)	24, 309, 357
BccI	CCATC	4 cut(s)	77, 85, 241, 329
BcgI	CGANNNNNNTGC	2 cut(s)	184, 218
BciT130I	CCWGG	5 cut(s)	238, 252, 363, 438, 528
BcoDI	GTCTC	3 cut(s)	185, 363, 373
BfmI	CTRYAG	2 cut(s)	480, 570
BglII	AGATCT	1 cut(s)	209
BisI	GCNGC	4 cut(s)	13, 295, 298, 346
BlsI	GCNGC	4 cut(s)	14, 296, 299, 347
Bme1390I	CCNGG	5 cut(s)	238, 252, 363, 438, 528
Bme18I	GGWCC	3 cut(s)	396, 434, 524
BmgBI	CACGTC	1 cut(s)	134
BmgT120I	GGNCC	3 cut(s)	396, 434, 524
BmiI	GGNNCC	1 cut(s)	398
BmrFI	CCNGG	5 cut(s)	238, 252, 363, 438, 528
BmsI	GCATC	2 cut(s)	55, 646
BpiI	GAAGAC	1 cut(s)	318
BplI	GAGNNNNNCTC	2 cut(s)	128, 160
BpmI	CTGGAG	3 cut(s)	132, 477, 567
BpuEI	CTTGAG	1 cut(s)	611
BsaBI	GATNNNNATC	1 cut(s)	232
BsaJI	CCNNGG	2 cut(s)	237, 318
Bsc4I	CCNNNNNNNGG	7 cut(s)	83, 155, 324, 407, 408, 475, 565
Bse8I	GATNNNNATC	1 cut(s)	232
BseBI	CCWGG	5 cut(s)	238, 252, 363, 438, 528
BseDI	CCNNGG	2 cut(s)	237, 318
BseGI	GGATG	4 cut(s)	96, 233, 334, 360
BseJI	GATNNNNATC	1 cut(s)	232
BseLI	CCNNNNNNNGG	7 cut(s)	83, 155, 324, 407, 408, 475, 565
BseXI	GCAGC	3 cut(s)	24, 309, 357
BshFI	GGCC	1 cut(s)	109
BslFI	GGGAC	1 cut(s)	382
BslI	CCNNNNNNNGG	7 cut(s)	83, 155, 324, 407, 408, 475, 565
BsmAI	GTCTC	3 cut(s)	185, 363, 373
BsmBI	CGTCTC	1 cut(s)	185
BsmFI	GGGAC	1 cut(s)	382
BsnI	GGCC	1 cut(s)	109
Bsp143I	GATC	4 cut(s)	209, 471, 561, 610
Bsp19I	CCATGG	1 cut(s)	318
BspACI	CCGC	2 cut(s)	101, 294
BspANI	GGCC	1 cut(s)	109
BspLI	GGNNCC	1 cut(s)	398
BspQI	GCTCTTC	2 cut(s)	31, 42
BssECI	CCNNGG	2 cut(s)	237, 318
BssMI	GATC	4 cut(s)	209, 471, 561, 610
BssT1I	CCWWGG	1 cut(s)	318
Bst2UI	CCWGG	5 cut(s)	238, 252, 363, 438, 528
Bst6I	CTCTTC	2 cut(s)	31, 42
BstDEI	CTNAG	1 cut(s)	213
BstDSI	CCRYGG	1 cut(s)	318
BstF5I	GGATG	4 cut(s)	96, 233, 334, 360
BstKTI	GATC	4 cut(s)	212, 474, 564, 613
BstMAI	GTCTC	3 cut(s)	185, 363, 373
BstMBI	GATC	4 cut(s)	209, 471, 561, 610
BstMWI	GCNNNNNNNGC	2 cut(s)	21, 49
BstNI	CCWGG	5 cut(s)	238, 252, 363, 438, 528
BstSCI	CCNGG	5 cut(s)	236, 250, 361, 436, 526
BstSFI	CTRYAG	2 cut(s)	480, 570
BstV1I	GCAGC	3 cut(s)	24, 309, 357
BstV2I	GAAGAC	1 cut(s)	318
BstX2I	RGATCY	1 cut(s)	209
BstYI	RGATCY	1 cut(s)	209
BsuRI	GGCC	1 cut(s)	109
BtgI	CCRYGG	1 cut(s)	318
BtrI	CACGTC	1 cut(s)	134
BtsCI	GGATG	4 cut(s)	96, 233, 334, 360
Cfr13I	GGNCC	3 cut(s)	396, 434, 524
CviAII	CATG	3 cut(s)	319, 475, 688
DdeI	CTNAG	1 cut(s)	213
DpnI	GATC	4 cut(s)	211, 473, 563, 612
DpnII	GATC	4 cut(s)	209, 471, 561, 610
DrdI	GACNNNNNNGTC	1 cut(s)	320
DseDI	GACNNNNNNGTC	1 cut(s)	320
Eam1104I	CTCTTC	2 cut(s)	31, 42
EarI	CTCTTC	2 cut(s)	31, 42
Eco130I	CCWWGG	1 cut(s)	318
Eco47I	GGWCC	3 cut(s)	396, 434, 524
Eco57I	CTGAAG	1 cut(s)	66
EcoRII	CCWGG	5 cut(s)	236, 250, 361, 436, 526
EcoT14I	CCWWGG	1 cut(s)	318
ErhI	CCWWGG	1 cut(s)	318
Esp3I	CGTCTC	1 cut(s)	185
FaeI	CATG	3 cut(s)	322, 478, 691
FaiI	YATR	9 cut(s)	74, 120, 203, 270, 320, 476, 482, 572, 689
FaqI	GGGAC	1 cut(s)	382
FatI	CATG	3 cut(s)	318, 474, 687
FauI	CCCGC	1 cut(s)	94
Fnu4HI	GCNGC	4 cut(s)	13, 295, 298, 346
FokI	GGATG	4 cut(s)	103, 220, 341, 367
Fsp4HI	GCNGC	4 cut(s)	13, 295, 298, 346
GluI	GCNGC	4 cut(s)	13, 295, 298, 346
GsuI	CTGGAG	3 cut(s)	132, 477, 567
HaeIII	GGCC	1 cut(s)	109
Hin1II	CATG	3 cut(s)	322, 478, 691
HindIII	AAGCTT	1 cut(s)	243
HinfI	GANTC	6 cut(s)	125, 314, 465, 490, 555, 580
Hpy188III	TCNNGA	6 cut(s)	129, 149, 368, 469, 559, 614
HpyCH4IV	ACGT	1 cut(s)	133
HpyCH4V	TGCA	5 cut(s)	68, 205, 345, 635, 659
HpyF10VI	GCNNNNNNNGC	2 cut(s)	21, 49
HpyF3I	CTNAG	1 cut(s)	213
HpySE526I	ACGT	1 cut(s)	133
Hsp92II	CATG	3 cut(s)	322, 478, 691
Kzo9I	GATC	4 cut(s)	209, 471, 561, 610
LguI	GCTCTTC	2 cut(s)	31, 42
LmnI	GCTCC	2 cut(s)	458, 548
Lsp1109I	GCAGC	3 cut(s)	24, 309, 357
LweI	GCATC	2 cut(s)	55, 646
MaeII	ACGT	1 cut(s)	133
MaeIII	GTNAC	1 cut(s)	680
MalI	GATC	4 cut(s)	211, 473, 563, 612
MboI	GATC	4 cut(s)	209, 471, 561, 610
MboII	GAAGA	6 cut(s)	18, 59, 74, 323, 344, 665
MflI	RGATCY	1 cut(s)	209
MluCI	AATT	2 cut(s)	56, 340
MlyI	GAGTC	3 cut(s)	308, 474, 564
MmeI	TCCRAC	1 cut(s)	68
MnlI	CCTC	4 cut(s)	63, 492, 658, 684
MslI	CAYNNNNRTG	2 cut(s)	273, 353
MspR9I	CCNGG	5 cut(s)	238, 252, 363, 438, 528
MvaI	CCWGG	5 cut(s)	238, 252, 363, 438, 528
MwoI	GCNNNNNNNGC	2 cut(s)	21, 49
NcoI	CCATGG	1 cut(s)	318
NdeII	GATC	4 cut(s)	209, 471, 561, 610
NlaIII	CATG	3 cut(s)	322, 478, 691
NlaIV	GGNNCC	1 cut(s)	398
PciSI	GCTCTTC	2 cut(s)	31, 42
PfeI	GAWTC	3 cut(s)	125, 490, 580
PflMI	CCANNNNNTGG	5 cut(s)	83, 155, 324, 475, 565
PkrI	GCNGC	4 cut(s)	14, 296, 299, 347
PleI	GAGTC	3 cut(s)	308, 473, 563
PpsI	GAGTC	3 cut(s)	308, 473, 563
Psp6I	CCWGG	5 cut(s)	236, 250, 361, 436, 526
PspGI	CCWGG	5 cut(s)	236, 250, 361, 436, 526
PspN4I	GGNNCC	1 cut(s)	398
PspPI	GGNCC	3 cut(s)	396, 434, 524
PsuI	RGATCY	1 cut(s)	209
RseI	CAYNNNNRTG	2 cut(s)	273, 353
SapI	GCTCTTC	2 cut(s)	31, 42
SatI	GCNGC	4 cut(s)	13, 295, 298, 346
Sau3AI	GATC	4 cut(s)	209, 471, 561, 610
Sau96I	GGNCC	3 cut(s)	396, 434, 524
SchI	GAGTC	3 cut(s)	308, 474, 564
ScrFI	CCNGG	5 cut(s)	238, 252, 363, 438, 528
SfaNI	GCATC	2 cut(s)	55, 646
SfcI	CTRYAG	2 cut(s)	480, 570
SinI	GGWCC	3 cut(s)	396, 434, 524
SmiMI	CAYNNNNRTG	2 cut(s)	273, 353
SmlI	CTYRAG	1 cut(s)	626
SmoI	CTYRAG	1 cut(s)	626
Sse9I	AATT	2 cut(s)	56, 340
SsiI	CCGC	2 cut(s)	101, 294
StyD4I	CCNGG	5 cut(s)	236, 250, 361, 436, 526
StyI	CCWWGG	1 cut(s)	318
TaiI	ACGT	1 cut(s)	136
TaqI	TCGA	1 cut(s)	497
TaqII	GACCGA	1 cut(s)	384
TasI	AATT	2 cut(s)	56, 340
TauI	GCSGC	1 cut(s)	297
TfiI	GAWTC	3 cut(s)	125, 490, 580
TseI	GCWGC	3 cut(s)	12, 297, 345
TspDTI	ATGAA	3 cut(s)	104, 291, 345
Van91I	CCANNNNNTGG	5 cut(s)	83, 155, 324, 475, 565
VpaK11BI	GGWCC	3 cut(s)	396, 434, 524
XcmI	CCANNNNNNNNNTGG	1 cut(s)	84

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.