AT3G01130

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Reverse (-)
44045 .. 45809
1765 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G01130.5

Sequence Viewer

Length: 162 bp
ATGGCGCCACCTCCAGGACTTTACTCCGGTACCAGCACTCTTGCTCTGGTTGCTCGTGCTTCGGCTTTCGGGTTGGGTCTCATCTACGGCAACATCAAGCTCAAGGCTTTAAAGATAAAGAAGAATTCGCAGATTAAGGCCGAAGCAAAGGCTCATCACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

53

Amino Acids

5.55

Weight (kDa)

10.3

Isoelectric Point (pI)

17.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 29
AccB1I GGYRCC 2 cut(s) 4, 29
AcsI RAATTY 1 cut(s) 124
AcyI GRCGYC 1 cut(s) 5
AfaI GTAC 1 cut(s) 31
AfiI CCNNNNNNNGG 1 cut(s) 14
AjnI CCWGG 1 cut(s) 13
AluBI AGCT 1 cut(s) 100
AluI AGCT 1 cut(s) 100
Alw26I GTCTC 1 cut(s) 83
AoxI GGCC 1 cut(s) 138
ApoI RAATTY 1 cut(s) 124
Asp718I GGTACC 1 cut(s) 29
AspLEI GCGC 1 cut(s) 7
BaeI ACNNNNGTAYC 2 cut(s) 13, 46
BanI GGYRCC 2 cut(s) 4, 29
BauI CACGAG 1 cut(s) 54
BceAI ACGGC 1 cut(s) 103
BciT130I CCWGG 1 cut(s) 15
BcoDI GTCTC 1 cut(s) 83
BfoI RGCGCY 1 cut(s) 8
Bme1390I CCNGG 1 cut(s) 15
BmiI GGNNCC 2 cut(s) 6, 31
BmrFI CCNGG 1 cut(s) 15
BpuEI CTTGAG 1 cut(s) 86
BsaHI GRCGYC 1 cut(s) 5
BsaI GGTCTC 1 cut(s) 83
BsaWI WCCGGW 1 cut(s) 26
Bsc4I CCNNNNNNNGG 1 cut(s) 14
BseBI CCWGG 1 cut(s) 15
BseLI CCNNNNNNNGG 1 cut(s) 14
BshFI GGCC 1 cut(s) 140
BshNI GGYRCC 2 cut(s) 4, 29
BsiSI CCGG 1 cut(s) 27
BslI CCNNNNNNNGG 1 cut(s) 14
BsmAI GTCTC 1 cut(s) 83
BsnI GGCC 1 cut(s) 140
Bso31I GGTCTC 1 cut(s) 83
BspANI GGCC 1 cut(s) 140
BspLI GGNNCC 2 cut(s) 6, 31
BspT107I GGYRCC 2 cut(s) 4, 29
BspTNI GGTCTC 1 cut(s) 83
BssNI GRCGYC 1 cut(s) 5
BssSI CACGAG 1 cut(s) 54
Bst2BI CACGAG 1 cut(s) 54
Bst2UI CCWGG 1 cut(s) 15
BstACI GRCGYC 1 cut(s) 5
BstH2I RGCGCY 1 cut(s) 8
BstHHI GCGC 1 cut(s) 7
BstMAI GTCTC 1 cut(s) 83
BstMWI GCNNNNNNNGC 1 cut(s) 50
BstNI CCWGG 1 cut(s) 15
BstSCI CCNGG 1 cut(s) 13
BsuRI GGCC 1 cut(s) 140
CfoI GCGC 1 cut(s) 7
Csp6I GTAC 1 cut(s) 30
CviJI RGCY 5 cut(s) 65, 100, 107, 140, 152
CviKI_1 RGCY 5 cut(s) 65, 100, 107, 140, 152
CviQI GTAC 1 cut(s) 30
DinI GGCGCC 1 cut(s) 6
DraI TTTAAA 1 cut(s) 111
Eco31I GGTCTC 1 cut(s) 83
EcoRI GAATTC 1 cut(s) 124
EcoRII CCWGG 1 cut(s) 13
EgeI GGCGCC 1 cut(s) 6
EheI GGCGCC 1 cut(s) 6
GlaI GCGC 1 cut(s) 6
HaeII RGCGCY 1 cut(s) 8
HaeIII GGCC 1 cut(s) 140
HapII CCGG 1 cut(s) 27
HhaI GCGC 1 cut(s) 7
Hin1I GRCGYC 1 cut(s) 5
Hin6I GCGC 1 cut(s) 5
HinP1I GCGC 1 cut(s) 5
HpaII CCGG 1 cut(s) 27
HpyF10VI GCNNNNNNNGC 1 cut(s) 50
Hsp92I GRCGYC 1 cut(s) 5
HspAI GCGC 1 cut(s) 5
KasI GGCGCC 1 cut(s) 4
KpnI GGTACC 1 cut(s) 33
LpnPI CCDG 4 cut(s) 27, 32, 40, 46
MboII GAAGA 1 cut(s) 133
MluCI AATT 1 cut(s) 124
Mly113I GGCGCC 1 cut(s) 5
MnlI CCTC 1 cut(s) 21
MseI TTAA 2 cut(s) 110, 135
MspI CCGG 1 cut(s) 27
MspR9I CCNGG 1 cut(s) 15
MvaI CCWGG 1 cut(s) 15
MwoI GCNNNNNNNGC 1 cut(s) 50
NarI GGCGCC 1 cut(s) 5
NlaIV GGNNCC 2 cut(s) 6, 31
PfoI TCCNGGA 1 cut(s) 13
PluTI GGCGCC 1 cut(s) 8
Psp6I CCWGG 1 cut(s) 13
PspGI CCWGG 1 cut(s) 13
PspN4I GGNNCC 2 cut(s) 6, 31
RsaI GTAC 1 cut(s) 31
RsaNI GTAC 1 cut(s) 30
SaqAI TTAA 2 cut(s) 110, 135
ScrFI CCNGG 1 cut(s) 15
SetI ASST 2 cut(s) 13, 102
SfoI GGCGCC 1 cut(s) 6
SmlI CTYRAG 1 cut(s) 101
SmoI CTYRAG 1 cut(s) 101
Sse9I AATT 1 cut(s) 124
SspDI GGCGCC 1 cut(s) 4
StyD4I CCNGG 1 cut(s) 13
TasI AATT 1 cut(s) 124
Tru1I TTAA 2 cut(s) 110, 135
Tru9I TTAA 2 cut(s) 110, 135
XapI RAATTY 1 cut(s) 124
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.