FvH4_2g40204

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb2
OG0005355
Physical Location & Seq
Forward (+)
28696262 .. 28697073
812 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_2g40204.t1

Sequence Viewer

Length: 267 bp
ATGGCACCACCTCCAGGACCCTATTCTGGAACCAGCACCCACGCCTTGGTGGCTCGTGCTTCCGCATTCTCTCTCGGACTCGTCTATGGAAGCATTAAGCTCAAGGCCCTCAAGGCTAAGGCTAAATATGGCTGCATCAAAGGCTCATCACTGAAAAGAGGTAGCGGCGTCGGCGGAGGAACAATCTCACTAACAGGGAAAGGCAACGTCGTTCTTGCAGTGACAGAGAACGGCGACGTCGTTCCTTTTCTATGCGGCTTCGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00190 ko01100 ko04714 map00190 map01100 map04714
Pfam Domains
Protein Families
ATP-synt_E

Protein Analysis

89

Amino Acids

8.75

Weight (kDa)

9.95

Isoelectric Point (pI)

13.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 240
AccB1I GGYRCC 1 cut(s) 4
AccB7I CCANNNNNTGG 1 cut(s) 46
AciI CCGC 4 cut(s) 63, 165, 174, 255
AcyI GRCGYC 2 cut(s) 168, 237
AfiI CCNNNNNNNGG 3 cut(s) 14, 26, 46
AjnI CCWGG 1 cut(s) 13
AluBI AGCT 1 cut(s) 100
AluI AGCT 1 cut(s) 100
AoxI GGCC 1 cut(s) 105
ApeKI GCWGC 1 cut(s) 132
AspS9I GGNCC 2 cut(s) 17, 106
AvaII GGWCC 1 cut(s) 17
BanI GGYRCC 1 cut(s) 4
BauI CACGAG 1 cut(s) 54
BbvI GCAGC 1 cut(s) 119
BceAI ACGGC 1 cut(s) 247
BciT130I CCWGG 1 cut(s) 15
BglI GCCNNNNNGGC 2 cut(s) 50, 113
BisI GCNGC 3 cut(s) 133, 166, 256
BlsI GCNGC 3 cut(s) 134, 167, 257
Bme1390I CCNGG 1 cut(s) 15
Bme18I GGWCC 1 cut(s) 17
BmgT120I GGNCC 2 cut(s) 17, 106
BmiI GGNNCC 3 cut(s) 6, 19, 31
BmrFI CCNGG 1 cut(s) 15
BmsI GCATC 1 cut(s) 144
Bpu10I CCTNAGC 1 cut(s) 117
BpuEI CTTGAG 2 cut(s) 86, 95
BsaHI GRCGYC 2 cut(s) 168, 237
BsaJI CCNNGG 1 cut(s) 45
Bsc4I CCNNNNNNNGG 3 cut(s) 14, 26, 46
BseBI CCWGG 1 cut(s) 15
BseDI CCNNGG 1 cut(s) 45
BseLI CCNNNNNNNGG 3 cut(s) 14, 26, 46
BseXI GCAGC 1 cut(s) 119
BshFI GGCC 1 cut(s) 107
BshNI GGYRCC 1 cut(s) 4
BslI CCNNNNNNNGG 3 cut(s) 14, 26, 46
BsmI GAATGC 1 cut(s) 65
BsnI GGCC 1 cut(s) 107
BspACI CCGC 4 cut(s) 63, 165, 174, 255
BspANI GGCC 1 cut(s) 107
BspLI GGNNCC 3 cut(s) 6, 19, 31
BspT107I GGYRCC 1 cut(s) 4
BssECI CCNNGG 1 cut(s) 45
BssNI GRCGYC 2 cut(s) 168, 237
BssSI CACGAG 1 cut(s) 54
BssT1I CCWWGG 1 cut(s) 45
Bst2BI CACGAG 1 cut(s) 54
Bst2UI CCWGG 1 cut(s) 15
BstACI GRCGYC 2 cut(s) 168, 237
BstDEI CTNAG 1 cut(s) 117
BstMWI GCNNNNNNNGC 4 cut(s) 50, 113, 141, 171
BstNI CCWGG 1 cut(s) 15
BstSCI CCNGG 1 cut(s) 13
BstV1I GCAGC 1 cut(s) 119
BsuRI GGCC 1 cut(s) 107
BtsI GCAGTG 1 cut(s) 225
BtsIMutI CAGTG 2 cut(s) 149, 225
Cfr13I GGNCC 2 cut(s) 17, 106
CseI GACGC 1 cut(s) 157
CviJI RGCY 8 cut(s) 53, 100, 107, 116, 122, 132, 144, 258
CviKI_1 RGCY 8 cut(s) 53, 100, 107, 116, 122, 132, 144, 258
DdeI CTNAG 1 cut(s) 117
EciI GGCGGA 1 cut(s) 189
Eco130I CCWWGG 1 cut(s) 45
Eco47I GGWCC 1 cut(s) 17
EcoO109I RGGNCCY 2 cut(s) 17, 106
EcoRII CCWGG 1 cut(s) 13
EcoT14I CCWWGG 1 cut(s) 45
ErhI CCWWGG 1 cut(s) 45
FaiI YATR 3 cut(s) 87, 129, 253
Fnu4HI GCNGC 3 cut(s) 133, 166, 256
Fsp4HI GCNGC 3 cut(s) 133, 166, 256
GluI GCNGC 3 cut(s) 133, 166, 256
HaeIII GGCC 1 cut(s) 107
HgaI GACGC 1 cut(s) 157
Hin1I GRCGYC 2 cut(s) 168, 237
HinfI GANTC 1 cut(s) 78
Hpy188I TCNGA 1 cut(s) 77
Hpy188III TCNNGA 1 cut(s) 27
Hpy99I CGWCG 4 cut(s) 173, 212, 239, 242
HpyCH4IV ACGT 2 cut(s) 207, 237
HpyCH4V TGCA 2 cut(s) 135, 218
HpyF10VI GCNNNNNNNGC 4 cut(s) 50, 113, 141, 171
HpyF3I CTNAG 1 cut(s) 117
HpySE526I ACGT 2 cut(s) 207, 237
Hsp92I GRCGYC 2 cut(s) 168, 237
LpnPI CCDG 4 cut(s) 12, 27, 46, 180
Lsp1109I GCAGC 1 cut(s) 119
LweI GCATC 1 cut(s) 144
MaeII ACGT 2 cut(s) 207, 237
MaeIII GTNAC 1 cut(s) 220
MlyI GAGTC 1 cut(s) 72
MnlI CCTC 4 cut(s) 21, 119, 152, 170
MseI TTAA 2 cut(s) 96, 265
MspR9I CCNGG 1 cut(s) 15
Mva1269I GAATGC 1 cut(s) 65
MvaI CCWGG 1 cut(s) 15
MwoI GCNNNNNNNGC 4 cut(s) 50, 113, 141, 171
NlaIV GGNNCC 3 cut(s) 6, 19, 31
NmuCI GTSAC 1 cut(s) 220
PcsI WCGNNNNNNNCGW 1 cut(s) 237
PctI GAATGC 1 cut(s) 65
PflMI CCANNNNNTGG 1 cut(s) 46
PfoI TCCNGGA 1 cut(s) 13
PkrI GCNGC 3 cut(s) 134, 167, 257
PleI GAGTC 1 cut(s) 72
PpsI GAGTC 1 cut(s) 72
PpuMI RGGWCCY 1 cut(s) 17
Psp5II RGGWCCY 1 cut(s) 17
Psp6I CCWGG 1 cut(s) 13
PspGI CCWGG 1 cut(s) 13
PspN4I GGNNCC 3 cut(s) 6, 19, 31
PspPI GGNCC 2 cut(s) 17, 106
PspPPI RGGWCCY 1 cut(s) 17
SaqAI TTAA 2 cut(s) 96, 265
SatI GCNGC 3 cut(s) 133, 166, 256
Sau96I GGNCC 2 cut(s) 17, 106
SchI GAGTC 1 cut(s) 72
ScrFI CCNGG 1 cut(s) 15
SetI ASST 5 cut(s) 13, 102, 163, 210, 240
SfaNI GCATC 1 cut(s) 144
SinI GGWCC 1 cut(s) 17
SmlI CTYRAG 2 cut(s) 101, 110
SmoI CTYRAG 2 cut(s) 101, 110
SsiI CCGC 4 cut(s) 63, 165, 174, 255
StyD4I CCNGG 1 cut(s) 13
StyI CCWWGG 1 cut(s) 45
TaiI ACGT 2 cut(s) 210, 240
TauI GCSGC 2 cut(s) 168, 258
Tru1I TTAA 2 cut(s) 96, 265
Tru9I TTAA 2 cut(s) 96, 265
TscAI CASTG 2 cut(s) 156, 225
TseFI GTSAC 1 cut(s) 220
TseI GCWGC 1 cut(s) 132
Tsp45I GTSAC 1 cut(s) 220
TspRI CASTG 2 cut(s) 156, 225
Van91I CCANNNNNTGG 1 cut(s) 46
VpaK11BI GGWCC 1 cut(s) 17
ZraI GACGTC 1 cut(s) 238
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.