Prupe.1G368600_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
OG0005355
Physical Location & Seq
Reverse (-)
33709300 .. 33710799
1500 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G368600.1

Sequence Viewer

Length: 162 bp
ATGGCACCACCTCCAGGCCCTTACTCTGGCACCAGCACCCTCGCATTGGTTGCTCGTGCATCGGCCTTCACTTTCGGTCTGGTTTATGGAAGCGTGAAGCTCAGGGTTCTCAAGATGAAGGCCAAGTCACATAAGAAAGCTGAAGCCAAGGCTAAACATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
ATP-synt_E

Protein Analysis

54

Amino Acids

5.6

Weight (kDa)

10.58

Isoelectric Point (pI)

31.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 4, 29
AcuI CTGAAG 1 cut(s) 162
AfiI CCNNNNNNNGG 3 cut(s) 14, 26, 46
AjnI CCWGG 1 cut(s) 13
AluBI AGCT 2 cut(s) 100, 140
AluI AGCT 2 cut(s) 100, 140
AoxI GGCC 3 cut(s) 16, 63, 120
AspS9I GGNCC 1 cut(s) 17
BanI GGYRCC 2 cut(s) 4, 29
BauI CACGAG 1 cut(s) 54
BciT130I CCWGG 1 cut(s) 15
Bme1390I CCNGG 1 cut(s) 15
BmgT120I GGNCC 1 cut(s) 17
BmiI GGNNCC 2 cut(s) 6, 31
BmrFI CCNGG 1 cut(s) 15
BmsI GCATC 1 cut(s) 68
Bpu10I CCTNAGC 1 cut(s) 101
BpuEI CTTGAG 1 cut(s) 95
BsaJI CCNNGG 1 cut(s) 147
Bsc4I CCNNNNNNNGG 3 cut(s) 14, 26, 46
BseBI CCWGG 1 cut(s) 15
BseDI CCNNGG 1 cut(s) 147
BseLI CCNNNNNNNGG 3 cut(s) 14, 26, 46
BseMII CTCAG 1 cut(s) 115
BshFI GGCC 3 cut(s) 18, 65, 122
BshNI GGYRCC 2 cut(s) 4, 29
BslI CCNNNNNNNGG 3 cut(s) 14, 26, 46
BsnI GGCC 3 cut(s) 18, 65, 122
BspANI GGCC 3 cut(s) 18, 65, 122
BspCNI CTCAG 1 cut(s) 114
BspLI GGNNCC 2 cut(s) 6, 31
BspT107I GGYRCC 2 cut(s) 4, 29
BssECI CCNNGG 1 cut(s) 147
BssSI CACGAG 1 cut(s) 54
BssT1I CCWWGG 1 cut(s) 147
Bst2BI CACGAG 1 cut(s) 54
Bst2UI CCWGG 1 cut(s) 15
BstAPI GCANNNNNTGC 1 cut(s) 50
BstDEI CTNAG 1 cut(s) 101
BstMWI GCNNNNNNNGC 1 cut(s) 50
BstNI CCWGG 1 cut(s) 15
BstSCI CCNGG 1 cut(s) 13
BsuRI GGCC 3 cut(s) 18, 65, 122
Cfr13I GGNCC 1 cut(s) 17
CviJI RGCY 7 cut(s) 18, 65, 100, 122, 140, 146, 152
CviKI_1 RGCY 7 cut(s) 18, 65, 100, 122, 140, 146, 152
DdeI CTNAG 1 cut(s) 101
Eco130I CCWWGG 1 cut(s) 147
Eco57I CTGAAG 1 cut(s) 162
EcoO109I RGGNCCY 1 cut(s) 17
EcoRII CCWGG 1 cut(s) 13
EcoT14I CCWWGG 1 cut(s) 147
ErhI CCWWGG 1 cut(s) 147
FaiI YATR 2 cut(s) 87, 132
HaeIII GGCC 3 cut(s) 18, 65, 122
Hpy188III TCNNGA 1 cut(s) 112
HpyAV CCTTC 2 cut(s) 76, 112
HpyCH4V TGCA 1 cut(s) 59
HpyF10VI GCNNNNNNNGC 1 cut(s) 50
HpyF3I CTNAG 1 cut(s) 101
LpnPI CCDG 5 cut(s) 12, 27, 46, 65, 88
LweI GCATC 1 cut(s) 68
MaeIII GTNAC 1 cut(s) 126
MnlI CCTC 2 cut(s) 21, 50
MspR9I CCNGG 1 cut(s) 15
MvaI CCWGG 1 cut(s) 15
MwoI GCNNNNNNNGC 1 cut(s) 50
NlaIV GGNNCC 2 cut(s) 6, 31
NmuCI GTSAC 1 cut(s) 126
Psp6I CCWGG 1 cut(s) 13
PspGI CCWGG 1 cut(s) 13
PspN4I GGNNCC 2 cut(s) 6, 31
PspPI GGNCC 1 cut(s) 17
Sau96I GGNCC 1 cut(s) 17
ScrFI CCNGG 1 cut(s) 15
SetI ASST 3 cut(s) 13, 102, 142
SfaNI GCATC 1 cut(s) 68
SmlI CTYRAG 1 cut(s) 110
SmoI CTYRAG 1 cut(s) 110
StyD4I CCNGG 1 cut(s) 13
StyI CCWWGG 1 cut(s) 147
TaqII GACCGA 1 cut(s) 65
TseFI GTSAC 1 cut(s) 126
Tsp45I GTSAC 1 cut(s) 126
TspDTI ATGAA 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.