AT5G15320

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
Physical Location & Seq
Forward (+)
4977470 .. 4979076
1607 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G15320.1

Sequence Viewer

Length: 162 bp
ATGACGCTACCTCCAGGTCTTTACTCCGGCACCAGCTCTCTTGCTCTGGTGGCTCGTGCTTCGGCTTTTGGGTTGGGTCTCGTCTATGGGAACATGAAGCTCAAGGTCCTTAAGATCAAATCGATGTCACAGAAGAAGGTTGAAGCCACCGCTCATCATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

5.6

Weight (kDa)

10.22

Isoelectric Point (pI)

13.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 29
AccBSI CCGCTC 1 cut(s) 152
AciI CCGC 1 cut(s) 150
AflII CTTAAG 1 cut(s) 110
AgsI TTSAA 1 cut(s) 143
AjnI CCWGG 1 cut(s) 13
AluBI AGCT 2 cut(s) 36, 100
AluI AGCT 2 cut(s) 36, 100
Alw26I GTCTC 1 cut(s) 83
AspS9I GGNCC 1 cut(s) 106
AvaII GGWCC 1 cut(s) 106
BanI GGYRCC 1 cut(s) 29
BauI CACGAG 1 cut(s) 54
BciT130I CCWGG 1 cut(s) 15
BcoDI GTCTC 1 cut(s) 83
BfrI CTTAAG 1 cut(s) 110
Bme1390I CCNGG 1 cut(s) 15
Bme18I GGWCC 1 cut(s) 106
BmgT120I GGNCC 1 cut(s) 106
BmiI GGNNCC 1 cut(s) 31
BmrFI CCNGG 1 cut(s) 15
BpuEI CTTGAG 1 cut(s) 86
Bsa29I ATCGAT 1 cut(s) 122
BsaI GGTCTC 1 cut(s) 83
BsaXI ACNNNNNCTCC 1 cut(s) 25
BseBI CCWGG 1 cut(s) 15
BseCI ATCGAT 1 cut(s) 122
BshNI GGYRCC 1 cut(s) 29
BshVI ATCGAT 1 cut(s) 122
BsiSI CCGG 1 cut(s) 27
BsmAI GTCTC 1 cut(s) 83
Bso31I GGTCTC 1 cut(s) 83
Bsp143I GATC 1 cut(s) 114
BspACI CCGC 1 cut(s) 150
BspDI ATCGAT 1 cut(s) 122
BspLI GGNNCC 1 cut(s) 31
BspT107I GGYRCC 1 cut(s) 29
BspTI CTTAAG 1 cut(s) 110
BspTNI GGTCTC 1 cut(s) 83
BsrBI CCGCTC 1 cut(s) 152
BssMI GATC 1 cut(s) 114
BssSI CACGAG 1 cut(s) 54
Bst2BI CACGAG 1 cut(s) 54
Bst2UI CCWGG 1 cut(s) 15
BstAFI CTTAAG 1 cut(s) 110
BstKTI GATC 1 cut(s) 117
BstMAI GTCTC 1 cut(s) 83
BstMBI GATC 1 cut(s) 114
BstMWI GCNNNNNNNGC 1 cut(s) 50
BstNI CCWGG 1 cut(s) 15
BstSCI CCNGG 1 cut(s) 13
Bsu15I ATCGAT 1 cut(s) 122
BsuTUI ATCGAT 1 cut(s) 122
Cfr13I GGNCC 1 cut(s) 106
ClaI ATCGAT 1 cut(s) 122
CseI GACGC 1 cut(s) 13
CviAII CATG 1 cut(s) 94
CviJI RGCY 5 cut(s) 36, 53, 65, 100, 146
CviKI_1 RGCY 5 cut(s) 36, 53, 65, 100, 146
DpnI GATC 1 cut(s) 116
DpnII GATC 1 cut(s) 114
Eco31I GGTCTC 1 cut(s) 83
Eco47I GGWCC 1 cut(s) 106
EcoO109I RGGNCCY 1 cut(s) 106
EcoRII CCWGG 1 cut(s) 13
FaeI CATG 1 cut(s) 97
FaiI YATR 2 cut(s) 87, 95
FatI CATG 1 cut(s) 93
HapII CCGG 1 cut(s) 27
HgaI GACGC 1 cut(s) 13
Hin1II CATG 1 cut(s) 97
HpaII CCGG 1 cut(s) 27
HpyAV CCTTC 1 cut(s) 130
HpyF10VI GCNNNNNNNGC 1 cut(s) 50
Hsp92II CATG 1 cut(s) 97
Kzo9I GATC 1 cut(s) 114
LpnPI CCDG 4 cut(s) 27, 32, 40, 46
MaeIII GTNAC 1 cut(s) 126
MalI GATC 1 cut(s) 116
MbiI CCGCTC 1 cut(s) 152
MboI GATC 1 cut(s) 114
MboII GAAGA 1 cut(s) 145
MnlI CCTC 1 cut(s) 21
MseI TTAA 2 cut(s) 111, 160
MspCI CTTAAG 1 cut(s) 110
MspI CCGG 1 cut(s) 27
MspR9I CCNGG 1 cut(s) 15
MvaI CCWGG 1 cut(s) 15
MwoI GCNNNNNNNGC 1 cut(s) 50
NdeII GATC 1 cut(s) 114
NlaIII CATG 1 cut(s) 97
NlaIV GGNNCC 1 cut(s) 31
NmuCI GTSAC 1 cut(s) 126
PpuMI RGGWCCY 1 cut(s) 106
Psp5II RGGWCCY 1 cut(s) 106
Psp6I CCWGG 1 cut(s) 13
PspGI CCWGG 1 cut(s) 13
PspN4I GGNNCC 1 cut(s) 31
PspPI GGNCC 1 cut(s) 106
PspPPI RGGWCCY 1 cut(s) 106
SaqAI TTAA 2 cut(s) 111, 160
Sau3AI GATC 1 cut(s) 114
Sau96I GGNCC 1 cut(s) 106
ScrFI CCNGG 1 cut(s) 15
SetI ASST 6 cut(s) 13, 19, 38, 102, 108, 141
SinI GGWCC 1 cut(s) 106
SmlI CTYRAG 2 cut(s) 101, 110
SmoI CTYRAG 2 cut(s) 101, 110
SsiI CCGC 1 cut(s) 150
StyD4I CCNGG 1 cut(s) 13
TaqI TCGA 1 cut(s) 122
Tru1I TTAA 2 cut(s) 111, 160
Tru9I TTAA 2 cut(s) 111, 160
TseFI GTSAC 1 cut(s) 126
Tsp45I GTSAC 1 cut(s) 126
TspDTI ATGAA 1 cut(s) 110
Vha464I CTTAAG 1 cut(s) 110
VpaK11BI GGWCC 1 cut(s) 106
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.