AT3G22930

calmodulin-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
OG0012718
Physical Location & Seq
Reverse (-)
8124020 .. 8125931
1912 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G22930.2

Sequence Viewer

Length: 522 bp
ATGGAAGAAATTCAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAAGAACTGACGCAAGAACAGATAATGGAGTTCAAAGAGGCTTTTTGTCTATTCGACAAAGATGGTGATGGATGCATCACTGCTGATGAACTTGCCACTGTGATCCGCTCATTGGATCAGAACCCTACCGAGCAAGAACTTCAAGATATGATCACTGAGATCGACTCCGATGGCAACGGCACCATCGAATTTTCGGAGTTTCTCAACCTCATGGCTAACCAACTCCAGGAAACTGATGCAGATGAAGAGCTGAAAGAAGCATTCAAAGTGTTTGACAAAGACCAAAATGGTTACATCTCTGCCAGTGAGTTGAGGCATGTGATGATTAATCTTGGGGAGAAGCTAACAGATGAAGAGGTTGATCAAATGATAAAAGAGGCAGATTTGGATGGTGATGGCCAAGTCAATTATGATGAATTTGTCAGGATGATGATGATCAATGGTTAA

Protein Analysis

173

Amino Acids

20.07

Weight (kDa)

4.05

Isoelectric Point (pI)

56.91

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AIF-1 PF21008 5 - 97 1.1e-08 Allograft inflammatory factor 1
SPARC_Ca_bdg PF10591 6 - 93 9.6e-06 Secreted protein acidic and rich in cysteine Ca binding region
EF-hand_1 PF00036 35 - 63 1.9e-08 EF hand domain
EF-hand_7 PF13499 35 - 96 2.6e-17 EF-hand domain pair
EF-hand_6 PF13405 35 - 63 2e-08 EF-hand domain
EF-hand_9 PF14658 39 - 97 1.3e-08 EF-hand domain
EF-hand_8 PF13833 48 - 98 4.2e-12 EF-hand domain pair
EF-hand_1 PF00036 71 - 98 1.6e-07 EF hand domain
EF-hand_1 PF00036 108 - 129 9.9e-07 EF hand domain
EF-hand_6 PF13405 108 - 129 1.3e-06 EF-hand domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012718)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G22930
fragaria_vesca FvH4_4g01760 FvH4_4g01760
malus_domestica MD13G1201800.v1.1 MD16G1202100.v1.1
prunus_persica Prupe.1G023600_v2.0.a1 Prupe.1G023600_v2.0.a1
pyrus_communis pycom13g17520 pycom16g17050
rosa_chinensis RchiOBHm_Chr4g0388611
rosa_laevigata RLG00000010034
rosa_multiflora Rmu_sc0004459.1_g000014
rosa_roxburghii Rroxscaffold_5G00335070
rosa_rugosa Rorug03G0319300 Rorug03G0319400
rosa_samantha Rh4BG016900 Rh4DG017700
rosa_wichuraiana Rw4G001690

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 254
AccBSI CCGCTC 1 cut(s) 183
AciI CCGC 1 cut(s) 181
AclWI GGATC 2 cut(s) 172, 198
AcoI YGGCCR 1 cut(s) 472
AcsI RAATTY 3 cut(s) 9, 263, 491
AfiI CCNNNNNNNGG 2 cut(s) 187, 301
AgsI TTSAA 4 cut(s) 14, 109, 218, 340
AjnI CCWGG 1 cut(s) 300
AluBI AGCT 2 cut(s) 325, 418
AluI AGCT 2 cut(s) 325, 418
AlwI GGATC 2 cut(s) 172, 198
AoxI GGCC 1 cut(s) 472
ApoI RAATTY 3 cut(s) 9, 263, 491
AseI ATTAAT 1 cut(s) 402
Asp700I GAANNNNTTC 1 cut(s) 9
AsuHPI GGTGA 2 cut(s) 152, 479
BalI TGGCCA 1 cut(s) 474
BanI GGYRCC 1 cut(s) 254
BccI CCATC 6 cut(s) 131, 137, 239, 266, 458, 464
BceAI ACGGC 1 cut(s) 268
BciT130I CCWGG 1 cut(s) 302
BclI TGATCA 3 cut(s) 225, 436, 510
Bme1390I CCNGG 1 cut(s) 302
BmiI GGNNCC 1 cut(s) 256
BmrFI CCNGG 1 cut(s) 302
BmsI GCATC 3 cut(s) 137, 159, 301
BplI GAGNNNNNCTC 2 cut(s) 224, 256
BpmI CTGGAG 1 cut(s) 284
BsaBI GATNNNNATC 1 cut(s) 509
Bsc4I CCNNNNNNNGG 2 cut(s) 187, 301
Bse1I ACTGG 1 cut(s) 378
Bse8I GATNNNNATC 1 cut(s) 509
BseBI CCWGG 1 cut(s) 302
BseGI GGATG 3 cut(s) 152, 469, 507
BseJI GATNNNNATC 1 cut(s) 509
BseLI CCNNNNNNNGG 2 cut(s) 187, 301
BseMII CTCAG 1 cut(s) 222
BseNI ACTGG 1 cut(s) 378
BshFI GGCC 1 cut(s) 474
BshNI GGYRCC 1 cut(s) 254
BslI CCNNNNNNNGG 2 cut(s) 187, 301
BsmI GAATGC 1 cut(s) 335
BsnI GGCC 1 cut(s) 474
Bsp143I GATC 6 cut(s) 177, 190, 225, 234, 436, 510
BspACI CCGC 1 cut(s) 181
BspANI GGCC 1 cut(s) 474
BspCNI CTCAG 1 cut(s) 223
BspLI GGNNCC 1 cut(s) 256
BspPI GGATC 2 cut(s) 172, 198
BspQI GCTCTTC 1 cut(s) 315
BspT107I GGYRCC 1 cut(s) 254
BsrBI CCGCTC 1 cut(s) 183
BsrI ACTGG 1 cut(s) 378
BssMI GATC 6 cut(s) 177, 190, 225, 234, 436, 510
Bst2UI CCWGG 1 cut(s) 302
Bst4CI ACNGT 1 cut(s) 175
Bst6I CTCTTC 2 cut(s) 315, 423
BstDEI CTNAG 1 cut(s) 231
BstF5I GGATG 3 cut(s) 152, 469, 507
BstKTI GATC 6 cut(s) 180, 193, 228, 237, 439, 513
BstMBI GATC 6 cut(s) 177, 190, 225, 234, 436, 510
BstNI CCWGG 1 cut(s) 302
BstNSI RCATGY 1 cut(s) 395
BstSCI CCNGG 1 cut(s) 300
BsuRI GGCC 1 cut(s) 474
BtsCI GGATG 3 cut(s) 152, 469, 507
BtsI GCAGTG 1 cut(s) 153
BtsIMutI CAGTG 4 cut(s) 153, 171, 228, 385
CseI GACGC 1 cut(s) 94
CviAII CATG 2 cut(s) 286, 392
CviJI RGCY 5 cut(s) 116, 290, 325, 418, 474
CviKI_1 RGCY 5 cut(s) 116, 290, 325, 418, 474
DdeI CTNAG 1 cut(s) 231
DpnI GATC 6 cut(s) 179, 192, 227, 236, 438, 512
DpnII GATC 6 cut(s) 177, 190, 225, 234, 436, 510
EaeI YGGCCR 1 cut(s) 472
Eam1104I CTCTTC 2 cut(s) 315, 423
EarI CTCTTC 2 cut(s) 315, 423
EcoRII CCWGG 1 cut(s) 300
EcoT22I ATGCAT 1 cut(s) 152
FaeI CATG 2 cut(s) 289, 395
FaiI YATR 4 cut(s) 224, 287, 393, 486
FatI CATG 2 cut(s) 285, 391
FbaI TGATCA 3 cut(s) 225, 436, 510
FokI GGATG 3 cut(s) 159, 476, 514
GsuI CTGGAG 1 cut(s) 284
HaeIII GGCC 1 cut(s) 474
HgaI GACGC 1 cut(s) 94
Hin1II CATG 2 cut(s) 289, 395
HinfI GANTC 1 cut(s) 239
HphI GGTGA 2 cut(s) 152, 479
Hpy188I TCNGA 3 cut(s) 195, 244, 271
Hpy188III TCNNGA 2 cut(s) 218, 499
HpyCH4III ACNGT 1 cut(s) 175
HpyCH4V TGCA 2 cut(s) 150, 314
HpyF3I CTNAG 1 cut(s) 231
Hsp92II CATG 2 cut(s) 289, 395
Ksp22I TGATCA 3 cut(s) 225, 436, 510
Kzo9I GATC 6 cut(s) 177, 190, 225, 234, 436, 510
LguI GCTCTTC 1 cut(s) 315
LpnPI CCDG 4 cut(s) 287, 314, 391, 484
LweI GCATC 3 cut(s) 137, 159, 301
MaeIII GTNAC 1 cut(s) 365
MalI GATC 6 cut(s) 179, 192, 227, 236, 438, 512
MbiI CCGCTC 1 cut(s) 183
MboI GATC 6 cut(s) 177, 190, 225, 234, 436, 510
MboII GAAGA 3 cut(s) 17, 332, 440
MlsI TGGCCA 1 cut(s) 474
MluCI AATT 4 cut(s) 9, 263, 481, 491
MluNI TGGCCA 1 cut(s) 474
MlyI GAGTC 1 cut(s) 233
MnlI CCTC 5 cut(s) 106, 293, 381, 424, 445
Mox20I TGGCCA 1 cut(s) 474
Mph1103I ATGCAT 1 cut(s) 152
MroXI GAANNNNTTC 1 cut(s) 9
MscI TGGCCA 1 cut(s) 474
MseI TTAA 2 cut(s) 402, 520
Msp20I TGGCCA 1 cut(s) 474
MspR9I CCNGG 1 cut(s) 302
Mva1269I GAATGC 1 cut(s) 335
MvaI CCWGG 1 cut(s) 302
NdeII GATC 6 cut(s) 177, 190, 225, 234, 436, 510
NlaIII CATG 2 cut(s) 289, 395
NlaIV GGNNCC 1 cut(s) 256
NsiI ATGCAT 1 cut(s) 152
NspI RCATGY 1 cut(s) 395
PciSI GCTCTTC 1 cut(s) 315
PcsI WCGNNNNNNNCGW 1 cut(s) 258
PctI GAATGC 1 cut(s) 335
PdmI GAANNNNTTC 1 cut(s) 9
PfoI TCCNGGA 1 cut(s) 300
PleI GAGTC 1 cut(s) 233
PpsI GAGTC 1 cut(s) 233
PshBI ATTAAT 1 cut(s) 402
Psp6I CCWGG 1 cut(s) 300
PspGI CCWGG 1 cut(s) 300
PspN4I GGNNCC 1 cut(s) 256
SapI GCTCTTC 1 cut(s) 315
SaqAI TTAA 2 cut(s) 402, 520
Sau3AI GATC 6 cut(s) 177, 190, 225, 234, 436, 510
SchI GAGTC 1 cut(s) 233
ScrFI CCNGG 1 cut(s) 302
SetI ASST 4 cut(s) 285, 327, 420, 435
SfaNI GCATC 3 cut(s) 137, 159, 301
Sse9I AATT 4 cut(s) 9, 263, 481, 491
SsiI CCGC 1 cut(s) 181
StyD4I CCNGG 1 cut(s) 300
TaaI ACNGT 1 cut(s) 175
TaqI TCGA 3 cut(s) 129, 237, 261
TasI AATT 4 cut(s) 9, 263, 481, 491
Tru1I TTAA 2 cut(s) 402, 520
Tru9I TTAA 2 cut(s) 402, 520
TscAI CASTG 4 cut(s) 160, 178, 235, 385
TspDTI ATGAA 4 cut(s) 177, 333, 441, 504
TspRI CASTG 4 cut(s) 160, 178, 235, 385
VspI ATTAAT 1 cut(s) 402
XapI RAATTY 3 cut(s) 9, 263, 491
XceI RCATGY 1 cut(s) 395
XmnI GAANNNNTTC 1 cut(s) 9
Zsp2I ATGCAT 1 cut(s) 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.