RLG00000010034

Calmodulin-like protein

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr2
Physical Location & Seq
Forward (+)
61920333 .. 61922052
1720 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000010034

Sequence Viewer

Length: 453 bp
ATGGCAGAGGTACTAAGTGAAGAACAGATTGTTGAATTTAAAGAGGCATTCTGTCTATTTGACAAGGATGGAGACGGTTGCATAACTGTCGAAGAATTGGCGACAGTTATCAGGTCTCTGGATCAAAATCCAACAGAGGAGGAACTTCAGGATATGATTAGTGAAGTTGATGCTGATGGAAATGGGACCATAGAGTTTGCAGAGTTCTTGAACTTGATGGCAAACAAAATGAAGGAAACGGATGCAGAGGAGGAGCTTAAAGAGGCCTTCAAGGTATTCGACAAGGATCAGAATGGATATATATCAGCTAATGAGCTGAGGCATGTAATGATCAATCTGGGAGAAAAACTGACGGACGAAGAGGTCGAGCAGATGATCAAGGAGGCCGATTTGGATGGCGATGGTCAAGTTAACTATGACGAATTTGTGAAGATGATGATGACCATTGGATGA

Protein Analysis

151

Amino Acids

17.02

Weight (kDa)

4.05

Isoelectric Point (pI)

41.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AIF-1 PF21008 7 - 76 3.6e-07 Allograft inflammatory factor 1
EF-hand_1 PF00036 12 - 40 1.8e-08 EF hand domain
EF-hand_6 PF13405 12 - 40 3.3e-08 EF-hand domain
EF-hand_7 PF13499 13 - 73 2.9e-17 EF-hand domain pair
EF-hand_9 PF14658 16 - 75 7.5e-09 EF-hand domain
EF-hand_8 PF13833 25 - 74 4.8e-11 EF-hand domain pair
EF-hand_1 PF00036 48 - 74 1.2e-07 EF hand domain
EF-hand_7 PF13499 83 - 147 2.7e-22 EF-hand domain pair
EF-hand_1 PF00036 85 - 112 2.9e-09 EF hand domain
EF-hand_6 PF13405 85 - 114 1.7e-09 EF-hand domain
EF-hand_5 PF13202 86 - 110 3.2e-06 EF hand
EF-hand_9 PF14658 88 - 148 1.9e-06 EF-hand domain
EF-hand_8 PF13833 101 - 146 1.9e-09 EF-hand domain pair
EF-hand_1 PF00036 121 - 148 4e-09 EF hand domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012718)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 362
AclWI GGATC 2 cut(s) 129, 294
AcsI RAATTY 2 cut(s) 35, 422
AcuI CTGAAG 1 cut(s) 131
AfaI GTAC 1 cut(s) 12
AgsI TTSAA 3 cut(s) 35, 211, 271
AluBI AGCT 3 cut(s) 256, 308, 316
AluI AGCT 3 cut(s) 256, 308, 316
Alw26I GTCTC 2 cut(s) 66, 120
AlwI GGATC 2 cut(s) 129, 294
AoxI GGCC 2 cut(s) 264, 384
ApoI RAATTY 2 cut(s) 35, 422
AspS9I GGNCC 1 cut(s) 186
AvaII GGWCC 1 cut(s) 186
BbvCI CCTCAGC 1 cut(s) 317
BccI CCATC 5 cut(s) 62, 170, 211, 389, 395
BcgI CGANNNNNNTGC 2 cut(s) 70, 104
BclI TGATCA 2 cut(s) 330, 375
BcoDI GTCTC 2 cut(s) 66, 120
Bme18I GGWCC 1 cut(s) 186
BmgT120I GGNCC 1 cut(s) 186
BmiI GGNNCC 1 cut(s) 187
BmsI GCATC 2 cut(s) 160, 232
Bpu10I CCTNAGC 1 cut(s) 317
BsaBI GATNNNNATC 2 cut(s) 126, 301
BsaI GGTCTC 1 cut(s) 120
Bse8I GATNNNNATC 2 cut(s) 126, 301
BseGI GGATG 3 cut(s) 73, 247, 400
BseJI GATNNNNATC 2 cut(s) 126, 301
BseMII CTCAG 1 cut(s) 308
BseRI GAGGAG 3 cut(s) 152, 263, 266
BshFI GGCC 2 cut(s) 266, 386
BslFI GGGAC 1 cut(s) 199
BsmAI GTCTC 2 cut(s) 66, 120
BsmBI CGTCTC 1 cut(s) 66
BsmFI GGGAC 1 cut(s) 199
BsmI GAATGC 1 cut(s) 47
BsnI GGCC 2 cut(s) 266, 386
Bso31I GGTCTC 1 cut(s) 120
Bsp143I GATC 4 cut(s) 121, 286, 330, 375
BspANI GGCC 2 cut(s) 266, 386
BspCNI CTCAG 1 cut(s) 309
BspLI GGNNCC 1 cut(s) 187
BspPI GGATC 2 cut(s) 129, 294
BspTNI GGTCTC 1 cut(s) 120
BssMI GATC 4 cut(s) 121, 286, 330, 375
Bst4CI ACNGT 3 cut(s) 77, 88, 106
Bst6I CTCTTC 1 cut(s) 354
BstDEI CTNAG 2 cut(s) 14, 317
BstF5I GGATG 3 cut(s) 73, 247, 400
BstKTI GATC 4 cut(s) 124, 289, 333, 378
BstMAI GTCTC 2 cut(s) 66, 120
BstMBI GATC 4 cut(s) 121, 286, 330, 375
BstNSI RCATGY 1 cut(s) 326
BsuRI GGCC 2 cut(s) 266, 386
BtgZI GCGATG 1 cut(s) 414
BtsCI GGATG 3 cut(s) 73, 247, 400
Cfr13I GGNCC 1 cut(s) 186
Csp6I GTAC 1 cut(s) 11
CviAII CATG 1 cut(s) 323
CviJI RGCY 5 cut(s) 256, 266, 308, 316, 386
CviKI_1 RGCY 5 cut(s) 256, 266, 308, 316, 386
CviQI GTAC 1 cut(s) 11
DdeI CTNAG 2 cut(s) 14, 317
DpnI GATC 4 cut(s) 123, 288, 332, 377
DpnII GATC 4 cut(s) 121, 286, 330, 375
DraI TTTAAA 1 cut(s) 40
DrdI GACNNNNNNGTC 1 cut(s) 362
DseDI GACNNNNNNGTC 1 cut(s) 362
Eam1104I CTCTTC 1 cut(s) 354
EarI CTCTTC 1 cut(s) 354
Eco147I AGGCCT 1 cut(s) 266
Eco31I GGTCTC 1 cut(s) 120
Eco47I GGWCC 1 cut(s) 186
Eco57I CTGAAG 1 cut(s) 131
Esp3I CGTCTC 1 cut(s) 66
FaeI CATG 1 cut(s) 326
FaiI YATR 7 cut(s) 83, 155, 191, 300, 302, 324, 417
FaqI GGGAC 1 cut(s) 199
FatI CATG 1 cut(s) 322
FbaI TGATCA 2 cut(s) 330, 375
FokI GGATG 3 cut(s) 80, 254, 407
HaeIII GGCC 2 cut(s) 266, 386
Hin1II CATG 1 cut(s) 326
HincII GTYRAC 1 cut(s) 412
HindII GTYRAC 1 cut(s) 412
HpaI GTTAAC 1 cut(s) 412
Hpy166II GTNNAC 1 cut(s) 412
Hpy188I TCNGA 1 cut(s) 291
Hpy188III TCNNGA 3 cut(s) 119, 149, 208
Hpy8I GTNNAC 1 cut(s) 412
HpyAV CCTTC 2 cut(s) 226, 277
HpyCH4III ACNGT 3 cut(s) 77, 88, 106
HpyCH4V TGCA 3 cut(s) 81, 200, 245
HpyF3I CTNAG 2 cut(s) 14, 317
Hsp92II CATG 1 cut(s) 326
Ksp22I TGATCA 2 cut(s) 330, 375
KspAI GTTAAC 1 cut(s) 412
Kzo9I GATC 4 cut(s) 121, 286, 330, 375
LmnI GCTCC 1 cut(s) 253
LpnPI CCDG 4 cut(s) 97, 104, 134, 323
LweI GCATC 2 cut(s) 160, 232
MalI GATC 4 cut(s) 123, 288, 332, 377
MboI GATC 4 cut(s) 121, 286, 330, 375
MboII GAAGA 4 cut(s) 32, 104, 371, 442
MluCI AATT 3 cut(s) 35, 95, 422
MmeI TCCRAC 1 cut(s) 155
MnlI CCTC 9 cut(s) 37, 130, 133, 241, 244, 256, 312, 355, 376
MseI TTAA 3 cut(s) 39, 258, 411
Mva1269I GAATGC 1 cut(s) 47
NdeII GATC 4 cut(s) 121, 286, 330, 375
NlaIII CATG 1 cut(s) 326
NlaIV GGNNCC 1 cut(s) 187
NspI RCATGY 1 cut(s) 326
PceI AGGCCT 1 cut(s) 266
PcsI WCGNNNNNNNCGW 1 cut(s) 363
PctI GAATGC 1 cut(s) 47
PspN4I GGNNCC 1 cut(s) 187
PspPI GGNCC 1 cut(s) 186
RsaI GTAC 1 cut(s) 12
RsaNI GTAC 1 cut(s) 11
SaqAI TTAA 3 cut(s) 39, 258, 411
Sau3AI GATC 4 cut(s) 121, 286, 330, 375
Sau96I GGNCC 1 cut(s) 186
SetI ASST 7 cut(s) 12, 116, 258, 276, 310, 318, 366
SfaNI GCATC 2 cut(s) 160, 232
SinI GGWCC 1 cut(s) 186
Sse9I AATT 3 cut(s) 35, 95, 422
SseBI AGGCCT 1 cut(s) 266
StuI AGGCCT 1 cut(s) 266
TaaI ACNGT 3 cut(s) 77, 88, 106
TaqI TCGA 3 cut(s) 90, 279, 366
TasI AATT 3 cut(s) 35, 95, 422
Tru1I TTAA 3 cut(s) 39, 258, 411
Tru9I TTAA 3 cut(s) 39, 258, 411
TspDTI ATGAA 1 cut(s) 245
TspGWI ACGGA 2 cut(s) 254, 368
VpaK11BI GGWCC 1 cut(s) 186
XapI RAATTY 2 cut(s) 35, 422
XceI RCATGY 1 cut(s) 326
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.