Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr4D

Orthogroup ID

OG0012718

Physical Location & Seq

Genomic Coordinates Reverse (-)

2831060 .. 2832769

Gene Structure 1710 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh4DG017700.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 453 bp

ATGGCAGAGGTACTAAGTGAAGAACAGATTGTTGAATTTAAAGAGGCATTCTGTCTATTTGACAAGGATGGAGACGGTTGCATAACTGTCGAAGAATTGGCGACAGTTATCCGGTCTCTGGATCAAAATCCAACAGAGGAGGAACTTCAGGATATGATTAGTGAAGTTGATGCTGATGGAAATGGGACCATAGAGTTTGCAGAGTTCTTGAACTTGATGGCAAACAAAATGAAGGAAACGGATGCAGAGGAGGAGCTTAAAGAGGCCTTCAAGGTATTCGACAAGGATCAGAATGGATATATATCAGCTAATGAGCTGAGGCATGTAATGATCAATCTAGGAGAAAAATTGACGGACGAAGAGGTCGAGCAGATGATCAAGGAGGCCGATTTGGATGGCGATGGTCAAGTTAACTATGACGAATTTGTGAAGATGATGATGACCATTGGATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005513 GO:0007154 GO:0007165 GO:0008150 GO:0009593 GO:0009987 GO:0010035 GO:0010038 GO:0019722 GO:0019932 GO:0023052 GO:0035556 GO:0042221 GO:0050789 GO:0050794 GO:0050896 GO:0051592 GO:0051606 GO:0051716 GO:0065007

KEGG Pathways

Metabolic & Signaling

ko04014 ko04015 ko04016 ko04020 ko04022 ko04024 ko04070 ko04114 ko04218 ko04261 ko04270 ko04371 ko04626 ko04713 ko04720 ko04722 ko04728 ko04740 ko04744 ko04745 ko04750 ko04910 ko04912 ko04915 ko04916 ko04921 ko04922 ko04924 ko04925 ko04970 ko04971 ko05010 ko05031 ko05034 ko05133 ko05152 ko05167 ko05200 ko05214 ko05418 map04014 map04015 map04016 map04020 map04022 map04024 map04070 map04114 map04218 map04261 map04270 map04371 map04626 map04713 map04720 map04722 map04728 map04740 map04744 map04745 map04750 map04910 map04912 map04915 map04916 map04921 map04922 map04924 map04925 map04970 map04971 map05010 map05031 map05034 map05133 map05152 map05167 map05200 map05214 map05418

Pfam Domains

Protein Families

EF-hand_1 EF-hand_7

Protein Analysis

150

Amino Acids

17.02

Weight (kDa)

4.05

Isoelectric Point (pI)

41.76

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
AIF-1	PF21008	7 - 76	3.6e-07	Allograft inflammatory factor 1
EF-hand_1	PF00036	12 - 40	1.8e-08	EF hand domain
EF-hand_6	PF13405	12 - 40	3.3e-08	EF-hand domain
EF-hand_7	PF13499	13 - 73	2.9e-17	EF-hand domain pair
EF-hand_9	PF14658	16 - 75	7.5e-09	EF-hand domain
EF-hand_8	PF13833	25 - 74	4.8e-11	EF-hand domain pair
EF-hand_1	PF00036	48 - 74	1.2e-07	EF hand domain
EF-hand_7	PF13499	83 - 147	2.7e-22	EF-hand domain pair
EF-hand_1	PF00036	85 - 112	2.9e-09	EF hand domain
EF-hand_6	PF13405	85 - 114	1.7e-09	EF-hand domain
EF-hand_5	PF13202	86 - 110	3.2e-06	EF hand
EF-hand_9	PF14658	88 - 148	1.9e-06	EF-hand domain
EF-hand_8	PF13833	101 - 146	1.9e-09	EF-hand domain pair
EF-hand_1	PF00036	121 - 148	4e-09	EF hand domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012718)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G22930
fragaria_vesca	FvH4_4g01760 FvH4_4g01760
malus_domestica	MD13G1201800.v1.1 MD16G1202100.v1.1
prunus_persica	Prupe.1G023600_v2.0.a1 Prupe.1G023600_v2.0.a1
pyrus_communis	pycom13g17520 pycom16g17050
rosa_chinensis	RchiOBHm_Chr4g0388611
rosa_laevigata	RLG00000010034
rosa_multiflora	Rmu_sc0004459.1_g000014
rosa_roxburghii	Rroxscaffold_5G00335070
rosa_rugosa	Rorug03G0319300 Rorug03G0319400
rosa_samantha	Rh4BG016900 Rh4DG017700
rosa_wichuraiana	Rw4G001690

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	362
AclWI	GGATC	2 cut(s)	129, 294
AcsI	RAATTY	2 cut(s)	35, 422
AcuI	CTGAAG	1 cut(s)	131
AfaI	GTAC	1 cut(s)	12
AfiI	CCNNNNNNNGG	1 cut(s)	118
AgsI	TTSAA	3 cut(s)	35, 211, 271
AluBI	AGCT	3 cut(s)	256, 308, 316
AluI	AGCT	3 cut(s)	256, 308, 316
Alw26I	GTCTC	2 cut(s)	66, 120
AlwI	GGATC	2 cut(s)	129, 294
AoxI	GGCC	2 cut(s)	264, 384
ApoI	RAATTY	2 cut(s)	35, 422
AspS9I	GGNCC	1 cut(s)	186
AvaII	GGWCC	1 cut(s)	186
BbvCI	CCTCAGC	1 cut(s)	317
BccI	CCATC	5 cut(s)	62, 170, 211, 389, 395
BcgI	CGANNNNNNTGC	2 cut(s)	70, 104
BclI	TGATCA	2 cut(s)	330, 375
BcoDI	GTCTC	2 cut(s)	66, 120
BfaI	CTAG	1 cut(s)	338
Bme18I	GGWCC	1 cut(s)	186
BmgT120I	GGNCC	1 cut(s)	186
BmiI	GGNNCC	1 cut(s)	187
BmsI	GCATC	2 cut(s)	160, 232
Bpu10I	CCTNAGC	1 cut(s)	317
BsaBI	GATNNNNATC	2 cut(s)	126, 301
BsaI	GGTCTC	1 cut(s)	120
BsaWI	WCCGGW	1 cut(s)	111
Bsc4I	CCNNNNNNNGG	1 cut(s)	118
Bse8I	GATNNNNATC	2 cut(s)	126, 301
BseGI	GGATG	3 cut(s)	73, 247, 400
BseJI	GATNNNNATC	2 cut(s)	126, 301
BseLI	CCNNNNNNNGG	1 cut(s)	118
BseMII	CTCAG	1 cut(s)	308
BseRI	GAGGAG	3 cut(s)	152, 263, 266
BshFI	GGCC	2 cut(s)	266, 386
BsiSI	CCGG	1 cut(s)	112
BslFI	GGGAC	1 cut(s)	199
BslI	CCNNNNNNNGG	1 cut(s)	118
BsmAI	GTCTC	2 cut(s)	66, 120
BsmBI	CGTCTC	1 cut(s)	66
BsmFI	GGGAC	1 cut(s)	199
BsmI	GAATGC	1 cut(s)	47
BsnI	GGCC	2 cut(s)	266, 386
Bso31I	GGTCTC	1 cut(s)	120
Bsp143I	GATC	4 cut(s)	121, 286, 330, 375
BspANI	GGCC	2 cut(s)	266, 386
BspCNI	CTCAG	1 cut(s)	309
BspLI	GGNNCC	1 cut(s)	187
BspPI	GGATC	2 cut(s)	129, 294
BspTNI	GGTCTC	1 cut(s)	120
BssMI	GATC	4 cut(s)	121, 286, 330, 375
Bst4CI	ACNGT	3 cut(s)	77, 88, 106
Bst6I	CTCTTC	1 cut(s)	354
BstDEI	CTNAG	2 cut(s)	14, 317
BstF5I	GGATG	3 cut(s)	73, 247, 400
BstKTI	GATC	4 cut(s)	124, 289, 333, 378
BstMAI	GTCTC	2 cut(s)	66, 120
BstMBI	GATC	4 cut(s)	121, 286, 330, 375
BstNSI	RCATGY	1 cut(s)	326
BsuRI	GGCC	2 cut(s)	266, 386
BtgZI	GCGATG	1 cut(s)	414
BtsCI	GGATG	3 cut(s)	73, 247, 400
Cfr13I	GGNCC	1 cut(s)	186
Csp6I	GTAC	1 cut(s)	11
CviAII	CATG	1 cut(s)	323
CviJI	RGCY	5 cut(s)	256, 266, 308, 316, 386
CviKI_1	RGCY	5 cut(s)	256, 266, 308, 316, 386
CviQI	GTAC	1 cut(s)	11
DdeI	CTNAG	2 cut(s)	14, 317
DpnI	GATC	4 cut(s)	123, 288, 332, 377
DpnII	GATC	4 cut(s)	121, 286, 330, 375
DraI	TTTAAA	1 cut(s)	40
DrdI	GACNNNNNNGTC	1 cut(s)	362
DseDI	GACNNNNNNGTC	1 cut(s)	362
Eam1104I	CTCTTC	1 cut(s)	354
EarI	CTCTTC	1 cut(s)	354
Eco147I	AGGCCT	1 cut(s)	266
Eco31I	GGTCTC	1 cut(s)	120
Eco47I	GGWCC	1 cut(s)	186
Eco57I	CTGAAG	1 cut(s)	131
Esp3I	CGTCTC	1 cut(s)	66
FaeI	CATG	1 cut(s)	326
FaiI	YATR	7 cut(s)	83, 155, 191, 300, 302, 324, 417
FaqI	GGGAC	1 cut(s)	199
FatI	CATG	1 cut(s)	322
FbaI	TGATCA	2 cut(s)	330, 375
FokI	GGATG	3 cut(s)	80, 254, 407
FspBI	CTAG	1 cut(s)	338
HaeIII	GGCC	2 cut(s)	266, 386
HapII	CCGG	1 cut(s)	112
Hin1II	CATG	1 cut(s)	326
HincII	GTYRAC	1 cut(s)	412
HindII	GTYRAC	1 cut(s)	412
HpaI	GTTAAC	1 cut(s)	412
HpaII	CCGG	1 cut(s)	112
Hpy166II	GTNNAC	1 cut(s)	412
Hpy188I	TCNGA	1 cut(s)	291
Hpy188III	TCNNGA	3 cut(s)	119, 149, 208
Hpy8I	GTNNAC	1 cut(s)	412
HpyAV	CCTTC	2 cut(s)	226, 277
HpyCH4III	ACNGT	3 cut(s)	77, 88, 106
HpyCH4V	TGCA	3 cut(s)	81, 200, 245
HpyF3I	CTNAG	2 cut(s)	14, 317
Hsp92II	CATG	1 cut(s)	326
Ksp22I	TGATCA	2 cut(s)	330, 375
KspAI	GTTAAC	1 cut(s)	412
Kzo9I	GATC	4 cut(s)	121, 286, 330, 375
LmnI	GCTCC	1 cut(s)	253
LpnPI	CCDG	3 cut(s)	104, 125, 134
LweI	GCATC	2 cut(s)	160, 232
MaeI	CTAG	1 cut(s)	338
MalI	GATC	4 cut(s)	123, 288, 332, 377
MboI	GATC	4 cut(s)	121, 286, 330, 375
MboII	GAAGA	4 cut(s)	32, 104, 371, 442
MluCI	AATT	4 cut(s)	35, 95, 347, 422
MmeI	TCCRAC	1 cut(s)	155
MnlI	CCTC	9 cut(s)	37, 130, 133, 241, 244, 256, 312, 355, 376
MseI	TTAA	3 cut(s)	39, 258, 411
MspI	CCGG	1 cut(s)	112
Mva1269I	GAATGC	1 cut(s)	47
NdeII	GATC	4 cut(s)	121, 286, 330, 375
NlaIII	CATG	1 cut(s)	326
NlaIV	GGNNCC	1 cut(s)	187
NspI	RCATGY	1 cut(s)	326
PceI	AGGCCT	1 cut(s)	266
PcsI	WCGNNNNNNNCGW	1 cut(s)	363
PctI	GAATGC	1 cut(s)	47
PspN4I	GGNNCC	1 cut(s)	187
PspPI	GGNCC	1 cut(s)	186
RsaI	GTAC	1 cut(s)	12
RsaNI	GTAC	1 cut(s)	11
SaqAI	TTAA	3 cut(s)	39, 258, 411
Sau3AI	GATC	4 cut(s)	121, 286, 330, 375
Sau96I	GGNCC	1 cut(s)	186
SetI	ASST	6 cut(s)	12, 258, 276, 310, 318, 366
SfaNI	GCATC	2 cut(s)	160, 232
SinI	GGWCC	1 cut(s)	186
Sse9I	AATT	4 cut(s)	35, 95, 347, 422
SseBI	AGGCCT	1 cut(s)	266
SspMI	CTAG	1 cut(s)	338
StuI	AGGCCT	1 cut(s)	266
TaaI	ACNGT	3 cut(s)	77, 88, 106
TaqI	TCGA	3 cut(s)	90, 279, 366
TasI	AATT	4 cut(s)	35, 95, 347, 422
Tru1I	TTAA	3 cut(s)	39, 258, 411
Tru9I	TTAA	3 cut(s)	39, 258, 411
TspDTI	ATGAA	1 cut(s)	245
TspGWI	ACGGA	2 cut(s)	254, 368
VpaK11BI	GGWCC	1 cut(s)	186
XapI	RAATTY	2 cut(s)	35, 422
XceI	RCATGY	1 cut(s)	326
XspI	CTAG	1 cut(s)	338

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.