MD16G1202100.v1.1

Calmodulin-like protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr16
Physical Location & Seq
Reverse (-)
18385681 .. 18387922
2242 bp
Loading structure...
UTR
Exon/CDS
Intron
MD16G1202100.v1.1.491

Sequence Viewer

Length: 453 bp
ATGGCAGACGTACTAAGCGAAGAACAGATTGTTGAGTTTAAAGAAGCATTTTGTCTATTTGACAAGGATGGAGATGGTTGCATTACTGTGGATGAACTGGCCACGGTGATTCGGTCTCTTGATCAGAATCCGACGGAGAAGGAGCTTCAGGACATGATAAGCGAAGTGGACGTTGACGGAAATGGAACCATAGAGTTTGCAGAGTTCTTGAGCTTAATGGCAAACAAAATGAAGGAAACTGATGCAGAGGAGGAGCTCAAAGAGGCCTTCAAAGTATTTGACAAGGATCAGAATGGTTATATTTCAGCTACTGAGCTGAGGCATGTAATGATCAATCTAGGAGAAAAATTGACGGACGAAGAGGTCGAGCAGATGATCAAGGAGGCGGATTTGGACGGTGATGGACAAGTGAATTACGATGAATTTGTGAAGATGATGATGACCATTGGATGA

Protein Analysis

151

Amino Acids

16.98

Weight (kDa)

4.05

Isoelectric Point (pI)

34.52

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AIF-1 PF21008 7 - 76 1.5e-06 Allograft inflammatory factor 1
EF-hand_1 PF00036 12 - 40 2.2e-08 EF hand domain
EF-hand_6 PF13405 12 - 40 2.9e-08 EF-hand domain
EF-hand_7 PF13499 13 - 73 6.6e-17 EF-hand domain pair
EF-hand_9 PF14658 16 - 75 2.1e-08 EF-hand domain
EF-hand_8 PF13833 25 - 74 1.7e-10 EF-hand domain pair
EF-hand_1 PF00036 48 - 74 7.9e-08 EF hand domain
EF-hand_7 PF13499 83 - 147 5e-22 EF-hand domain pair
AIF-1 PF21008 84 - 147 7.2e-06 Allograft inflammatory factor 1
EF-hand_1 PF00036 85 - 112 7.2e-09 EF hand domain
EF-hand_6 PF13405 85 - 114 3.4e-09 EF-hand domain
EF-hand_5 PF13202 86 - 110 3.5e-06 EF hand
EF-hand_9 PF14658 88 - 148 1e-06 EF-hand domain
EF-hand_8 PF13833 101 - 146 6.1e-10 EF-hand domain pair
EF-hand_1 PF00036 121 - 148 4e-09 EF hand domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012718)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 362
AciI CCGC 1 cut(s) 386
AclWI GGATC 1 cut(s) 294
AcoI YGGCCR 1 cut(s) 99
AcsI RAATTY 1 cut(s) 422
AcuI CTGAAG 1 cut(s) 131
AfaI GTAC 1 cut(s) 12
AgsI TTSAA 1 cut(s) 271
AluBI AGCT 5 cut(s) 145, 213, 256, 308, 316
AluI AGCT 5 cut(s) 145, 213, 256, 308, 316
Alw21I GWGCWC 1 cut(s) 258
Alw26I GTCTC 1 cut(s) 120
AlwI GGATC 1 cut(s) 294
AlwNI CAGNNNCTG 1 cut(s) 311
AoxI GGCC 2 cut(s) 99, 264
ApoI RAATTY 1 cut(s) 422
AsuHPI GGTGA 2 cut(s) 118, 410
BalI TGGCCA 1 cut(s) 101
BanII GRGCYC 1 cut(s) 258
Bbv12I GWGCWC 1 cut(s) 258
BbvCI CCTCAGC 1 cut(s) 317
BccI CCATC 3 cut(s) 62, 68, 395
BclI TGATCA 3 cut(s) 121, 330, 375
BcoDI GTCTC 1 cut(s) 120
BfaI CTAG 1 cut(s) 338
BmiI GGNNCC 1 cut(s) 187
BmsI GCATC 1 cut(s) 232
Bpu10I CCTNAGC 1 cut(s) 317
BpuEI CTTGAG 1 cut(s) 229
BsaBI GATNNNNATC 1 cut(s) 126
BsaI GGTCTC 1 cut(s) 120
BsaJI CCNNGG 1 cut(s) 102
Bse1I ACTGG 1 cut(s) 102
Bse8I GATNNNNATC 1 cut(s) 126
BseDI CCNNGG 1 cut(s) 102
BseGI GGATG 2 cut(s) 73, 97
BseJI GATNNNNATC 1 cut(s) 126
BseMII CTCAG 2 cut(s) 303, 308
BseNI ACTGG 1 cut(s) 102
BseRI GAGGAG 2 cut(s) 263, 266
BshFI GGCC 2 cut(s) 101, 266
BsiHKAI GWGCWC 1 cut(s) 258
BsmAI GTCTC 1 cut(s) 120
BsnI GGCC 2 cut(s) 101, 266
Bso31I GGTCTC 1 cut(s) 120
Bsp1286I GDGCHC 1 cut(s) 258
Bsp143I GATC 4 cut(s) 121, 286, 330, 375
BspACI CCGC 1 cut(s) 386
BspANI GGCC 2 cut(s) 101, 266
BspCNI CTCAG 2 cut(s) 304, 309
BspLI GGNNCC 1 cut(s) 187
BspPI GGATC 1 cut(s) 294
BspTNI GGTCTC 1 cut(s) 120
BsrI ACTGG 1 cut(s) 102
BssECI CCNNGG 1 cut(s) 102
BssMI GATC 4 cut(s) 121, 286, 330, 375
Bst4CI ACNGT 3 cut(s) 88, 106, 398
Bst6I CTCTTC 1 cut(s) 354
BstDEI CTNAG 3 cut(s) 14, 312, 317
BstDSI CCRYGG 1 cut(s) 102
BstF5I GGATG 2 cut(s) 73, 97
BstKTI GATC 4 cut(s) 124, 289, 333, 378
BstMAI GTCTC 1 cut(s) 120
BstMBI GATC 4 cut(s) 121, 286, 330, 375
BstNSI RCATGY 1 cut(s) 326
BsuRI GGCC 2 cut(s) 101, 266
BtgI CCRYGG 1 cut(s) 102
BtsCI GGATG 2 cut(s) 73, 97
CaiI CAGNNNCTG 1 cut(s) 311
Csp6I GTAC 1 cut(s) 11
CviAII CATG 2 cut(s) 154, 323
CviJI RGCY 7 cut(s) 101, 145, 213, 256, 266, 308, 316
CviKI_1 RGCY 7 cut(s) 101, 145, 213, 256, 266, 308, 316
CviQI GTAC 1 cut(s) 11
DdeI CTNAG 3 cut(s) 14, 312, 317
DpnI GATC 4 cut(s) 123, 288, 332, 377
DpnII GATC 4 cut(s) 121, 286, 330, 375
DraI TTTAAA 1 cut(s) 40
DrdI GACNNNNNNGTC 1 cut(s) 362
DseDI GACNNNNNNGTC 1 cut(s) 362
EaeI YGGCCR 1 cut(s) 99
Eam1104I CTCTTC 1 cut(s) 354
EarI CTCTTC 1 cut(s) 354
EciI GGCGGA 1 cut(s) 401
Ecl136II GAGCTC 1 cut(s) 256
Eco147I AGGCCT 1 cut(s) 266
Eco24I GRGCYC 1 cut(s) 258
Eco31I GGTCTC 1 cut(s) 120
Eco53kI GAGCTC 1 cut(s) 256
Eco57I CTGAAG 1 cut(s) 131
EcoICRI GAGCTC 1 cut(s) 256
EcoT38I GRGCYC 1 cut(s) 258
FaeI CATG 2 cut(s) 157, 326
FaiI YATR 4 cut(s) 155, 191, 300, 324
FatI CATG 2 cut(s) 153, 322
FbaI TGATCA 3 cut(s) 121, 330, 375
FokI GGATG 2 cut(s) 80, 104
FriOI GRGCYC 1 cut(s) 258
FspBI CTAG 1 cut(s) 338
HaeIII GGCC 2 cut(s) 101, 266
Hin1II CATG 2 cut(s) 157, 326
HincII GTYRAC 1 cut(s) 175
HindII GTYRAC 1 cut(s) 175
HinfI GANTC 2 cut(s) 109, 127
HphI GGTGA 2 cut(s) 118, 410
Hpy166II GTNNAC 2 cut(s) 169, 175
Hpy188I TCNGA 3 cut(s) 126, 132, 291
Hpy188III TCNNGA 3 cut(s) 119, 149, 208
Hpy8I GTNNAC 2 cut(s) 169, 175
Hpy99I CGWCG 1 cut(s) 136
HpyAV CCTTC 3 cut(s) 133, 226, 277
HpyCH4III ACNGT 3 cut(s) 88, 106, 398
HpyCH4IV ACGT 2 cut(s) 9, 171
HpyCH4V TGCA 3 cut(s) 81, 200, 245
HpyF3I CTNAG 3 cut(s) 14, 312, 317
HpySE526I ACGT 2 cut(s) 9, 171
Hsp92II CATG 2 cut(s) 157, 326
Ksp22I TGATCA 3 cut(s) 121, 330, 375
Kzo9I GATC 4 cut(s) 121, 286, 330, 375
LmnI GCTCC 2 cut(s) 142, 253
LpnPI CCDG 2 cut(s) 83, 134
LweI GCATC 1 cut(s) 232
MaeI CTAG 1 cut(s) 338
MaeII ACGT 2 cut(s) 9, 171
MalI GATC 4 cut(s) 123, 288, 332, 377
MboI GATC 4 cut(s) 121, 286, 330, 375
MboII GAAGA 3 cut(s) 32, 371, 442
MhlI GDGCHC 1 cut(s) 258
MlsI TGGCCA 1 cut(s) 101
MluCI AATT 3 cut(s) 347, 412, 422
MluNI TGGCCA 1 cut(s) 101
MmeI TCCRAC 1 cut(s) 155
MnlI CCTC 6 cut(s) 241, 244, 256, 312, 355, 376
Mox20I TGGCCA 1 cut(s) 101
MscI TGGCCA 1 cut(s) 101
MseI TTAA 2 cut(s) 39, 215
MslI CAYNNNNRTG 1 cut(s) 86
Msp20I TGGCCA 1 cut(s) 101
NdeII GATC 4 cut(s) 121, 286, 330, 375
NlaIII CATG 2 cut(s) 157, 326
NlaIV GGNNCC 1 cut(s) 187
NspI RCATGY 1 cut(s) 326
PceI AGGCCT 1 cut(s) 266
PcsI WCGNNNNNNNCGW 2 cut(s) 15, 363
PfeI GAWTC 2 cut(s) 109, 127
Psp124BI GAGCTC 1 cut(s) 258
PspN4I GGNNCC 1 cut(s) 187
PstNI CAGNNNCTG 1 cut(s) 311
RsaI GTAC 1 cut(s) 12
RsaNI GTAC 1 cut(s) 11
RseI CAYNNNNRTG 1 cut(s) 86
SacI GAGCTC 1 cut(s) 258
SaqAI TTAA 2 cut(s) 39, 215
Sau3AI GATC 4 cut(s) 121, 286, 330, 375
SduI GDGCHC 1 cut(s) 258
SetI ASST 8 cut(s) 12, 147, 174, 215, 258, 310, 318, 366
SfaNI GCATC 1 cut(s) 232
SmiMI CAYNNNNRTG 1 cut(s) 86
SmlI CTYRAG 1 cut(s) 208
SmoI CTYRAG 1 cut(s) 208
Sse9I AATT 3 cut(s) 347, 412, 422
SseBI AGGCCT 1 cut(s) 266
SsiI CCGC 1 cut(s) 386
SspMI CTAG 1 cut(s) 338
SstI GAGCTC 1 cut(s) 258
StuI AGGCCT 1 cut(s) 266
TaaI ACNGT 3 cut(s) 88, 106, 398
TaiI ACGT 2 cut(s) 12, 174
TaqI TCGA 1 cut(s) 366
TaqII GACCGA 1 cut(s) 102
TasI AATT 3 cut(s) 347, 412, 422
TfiI GAWTC 2 cut(s) 109, 127
Tru1I TTAA 2 cut(s) 39, 215
Tru9I TTAA 2 cut(s) 39, 215
TspDTI ATGAA 3 cut(s) 108, 245, 435
TspGWI ACGGA 3 cut(s) 149, 192, 368
XapI RAATTY 1 cut(s) 422
XceI RCATGY 1 cut(s) 326
XspI CTAG 1 cut(s) 338
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.