Rh4BG016900

Calmodulin-like protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Reverse (-)
2703357 .. 2706293
2937 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG016900.1

Sequence Viewer

Length: 483 bp
ATGGATCCGCGAACGAATTTGCGAAACCAAACATCTGAGGTACTAAGTGAAGAACAGATTGTTGAATTTAAAGAGGCATTTTGTCTATTTGACAAGGATGGAGACGGTTGCATAACTGTCGAAGAATTGGCGACAGTTATCCGGTCTCTGGATCAAAATCCAACAGAGGAGGAACTTCAGGATATGATTAGTGAAGTTGATGCTGATGGAAATGGGACCATAGAGTTTGCAGAGTTCTTGAACTTGATGGCAAACAAAATGAAGGAAACGGATGCAGAGGAGGAGCTTAAAGAGGCCTTCAAGGTATTCGACAAGGATCAGAATGGATATATATCAGCTAATGAGCTGAGGCATGTAATGATCAATCTAGGAGAAAAACTGACGGACGAAGAGGTCGAGCAGATGATCAAGGAGGCCGATTTGGATGGCGATGGTCAAGTTAACTATGACGAATTTGTGAAGATGATGATGACCATTGGATGA

Protein Analysis

160

Amino Acids

18.23

Weight (kDa)

4.06

Isoelectric Point (pI)

40.3

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AIF-1 PF21008 17 - 86 2.5e-07 Allograft inflammatory factor 1
EF-hand_1 PF00036 22 - 50 1.9e-08 EF hand domain
EF-hand_6 PF13405 22 - 50 3.7e-08 EF-hand domain
EF-hand_7 PF13499 23 - 83 3.3e-17 EF-hand domain pair
EF-hand_9 PF14658 26 - 85 8.7e-09 EF-hand domain
EF-hand_8 PF13833 35 - 84 5.4e-11 EF-hand domain pair
EF-hand_1 PF00036 58 - 84 1.4e-07 EF hand domain
EF-hand_7 PF13499 93 - 157 3.1e-22 EF-hand domain pair
EF-hand_1 PF00036 95 - 122 3.2e-09 EF hand domain
EF-hand_6 PF13405 95 - 124 1.9e-09 EF-hand domain
EF-hand_5 PF13202 96 - 120 3.5e-06 EF hand
EF-hand_9 PF14658 98 - 158 2.2e-06 EF-hand domain
EF-hand_8 PF13833 115 - 156 9.9e-09 EF-hand domain pair
EF-hand_1 PF00036 131 - 158 4.5e-09 EF hand domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012718)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 392
AccII CGCG 1 cut(s) 10
AciI CCGC 1 cut(s) 8
AclWI GGATC 3 cut(s) 12, 159, 324
AcsI RAATTY 3 cut(s) 16, 65, 452
AcuI CTGAAG 1 cut(s) 161
AfaI GTAC 1 cut(s) 42
AfiI CCNNNNNNNGG 1 cut(s) 148
AgsI TTSAA 3 cut(s) 65, 241, 301
AluBI AGCT 3 cut(s) 286, 338, 346
AluI AGCT 3 cut(s) 286, 338, 346
Alw26I GTCTC 2 cut(s) 96, 150
AlwI GGATC 3 cut(s) 12, 159, 324
AoxI GGCC 2 cut(s) 294, 414
ApoI RAATTY 3 cut(s) 16, 65, 452
AspS9I GGNCC 1 cut(s) 216
AvaII GGWCC 1 cut(s) 216
BamHI GGATCC 1 cut(s) 4
BbvCI CCTCAGC 1 cut(s) 347
BccI CCATC 5 cut(s) 92, 200, 241, 419, 425
BcgI CGANNNNNNTGC 2 cut(s) 100, 134
BclI TGATCA 2 cut(s) 360, 405
BcoDI GTCTC 2 cut(s) 96, 150
BfaI CTAG 1 cut(s) 368
Bme18I GGWCC 1 cut(s) 216
BmgT120I GGNCC 1 cut(s) 216
BmiI GGNNCC 2 cut(s) 6, 217
BmsI GCATC 2 cut(s) 190, 262
Bpu10I CCTNAGC 1 cut(s) 347
BsaBI GATNNNNATC 2 cut(s) 156, 331
BsaI GGTCTC 1 cut(s) 150
BsaWI WCCGGW 1 cut(s) 141
Bsc4I CCNNNNNNNGG 1 cut(s) 148
Bse8I GATNNNNATC 2 cut(s) 156, 331
BseGI GGATG 3 cut(s) 103, 277, 430
BseJI GATNNNNATC 2 cut(s) 156, 331
BseLI CCNNNNNNNGG 1 cut(s) 148
BseMII CTCAG 2 cut(s) 27, 338
BseRI GAGGAG 3 cut(s) 182, 293, 296
Bsh1236I CGCG 1 cut(s) 10
BshFI GGCC 2 cut(s) 296, 416
BsiSI CCGG 1 cut(s) 142
BslFI GGGAC 1 cut(s) 229
BslI CCNNNNNNNGG 1 cut(s) 148
BsmAI GTCTC 2 cut(s) 96, 150
BsmBI CGTCTC 1 cut(s) 96
BsmFI GGGAC 1 cut(s) 229
BsnI GGCC 2 cut(s) 296, 416
Bso31I GGTCTC 1 cut(s) 150
Bsp143I GATC 5 cut(s) 4, 151, 316, 360, 405
BspACI CCGC 1 cut(s) 8
BspANI GGCC 2 cut(s) 296, 416
BspCNI CTCAG 2 cut(s) 28, 339
BspFNI CGCG 1 cut(s) 10
BspLI GGNNCC 2 cut(s) 6, 217
BspPI GGATC 3 cut(s) 12, 159, 324
BspTNI GGTCTC 1 cut(s) 150
BssMI GATC 5 cut(s) 4, 151, 316, 360, 405
Bst4CI ACNGT 3 cut(s) 107, 118, 136
Bst6I CTCTTC 1 cut(s) 384
BstDEI CTNAG 3 cut(s) 36, 44, 347
BstF5I GGATG 3 cut(s) 103, 277, 430
BstFNI CGCG 1 cut(s) 10
BstKTI GATC 5 cut(s) 7, 154, 319, 363, 408
BstMAI GTCTC 2 cut(s) 96, 150
BstMBI GATC 5 cut(s) 4, 151, 316, 360, 405
BstNSI RCATGY 1 cut(s) 356
BstUI CGCG 1 cut(s) 10
BstX2I RGATCY 1 cut(s) 4
BstYI RGATCY 1 cut(s) 4
BsuRI GGCC 2 cut(s) 296, 416
BtgZI GCGATG 1 cut(s) 444
BtsCI GGATG 3 cut(s) 103, 277, 430
Cfr13I GGNCC 1 cut(s) 216
Csp6I GTAC 1 cut(s) 41
CviAII CATG 1 cut(s) 353
CviJI RGCY 5 cut(s) 286, 296, 338, 346, 416
CviKI_1 RGCY 5 cut(s) 286, 296, 338, 346, 416
CviQI GTAC 1 cut(s) 41
DdeI CTNAG 3 cut(s) 36, 44, 347
DpnI GATC 5 cut(s) 6, 153, 318, 362, 407
DpnII GATC 5 cut(s) 4, 151, 316, 360, 405
DraI TTTAAA 1 cut(s) 70
DrdI GACNNNNNNGTC 1 cut(s) 392
DseDI GACNNNNNNGTC 1 cut(s) 392
Eam1104I CTCTTC 1 cut(s) 384
EarI CTCTTC 1 cut(s) 384
Eco147I AGGCCT 1 cut(s) 296
Eco31I GGTCTC 1 cut(s) 150
Eco47I GGWCC 1 cut(s) 216
Eco57I CTGAAG 1 cut(s) 161
Esp3I CGTCTC 1 cut(s) 96
FaeI CATG 1 cut(s) 356
FaiI YATR 7 cut(s) 113, 185, 221, 330, 332, 354, 447
FaqI GGGAC 1 cut(s) 229
FatI CATG 1 cut(s) 352
FbaI TGATCA 2 cut(s) 360, 405
FokI GGATG 3 cut(s) 110, 284, 437
FspBI CTAG 1 cut(s) 368
HaeIII GGCC 2 cut(s) 296, 416
HapII CCGG 1 cut(s) 142
Hin1II CATG 1 cut(s) 356
HincII GTYRAC 1 cut(s) 442
HindII GTYRAC 1 cut(s) 442
HpaI GTTAAC 1 cut(s) 442
HpaII CCGG 1 cut(s) 142
Hpy166II GTNNAC 1 cut(s) 442
Hpy188I TCNGA 2 cut(s) 37, 321
Hpy188III TCNNGA 3 cut(s) 149, 179, 238
Hpy8I GTNNAC 1 cut(s) 442
HpyAV CCTTC 2 cut(s) 256, 307
HpyCH4III ACNGT 3 cut(s) 107, 118, 136
HpyCH4V TGCA 3 cut(s) 111, 230, 275
HpyF3I CTNAG 3 cut(s) 36, 44, 347
Hsp92II CATG 1 cut(s) 356
Ksp22I TGATCA 2 cut(s) 360, 405
KspAI GTTAAC 1 cut(s) 442
Kzo9I GATC 5 cut(s) 4, 151, 316, 360, 405
LmnI GCTCC 1 cut(s) 283
LpnPI CCDG 3 cut(s) 134, 155, 164
LweI GCATC 2 cut(s) 190, 262
MaeI CTAG 1 cut(s) 368
MalI GATC 5 cut(s) 6, 153, 318, 362, 407
MboI GATC 5 cut(s) 4, 151, 316, 360, 405
MboII GAAGA 4 cut(s) 62, 134, 401, 472
MflI RGATCY 1 cut(s) 4
MluCI AATT 4 cut(s) 16, 65, 125, 452
MmeI TCCRAC 1 cut(s) 185
MseI TTAA 3 cut(s) 69, 288, 441
MspI CCGG 1 cut(s) 142
MvnI CGCG 1 cut(s) 10
NdeII GATC 5 cut(s) 4, 151, 316, 360, 405
NlaIII CATG 1 cut(s) 356
NlaIV GGNNCC 2 cut(s) 6, 217
NspI RCATGY 1 cut(s) 356
PceI AGGCCT 1 cut(s) 296
PcsI WCGNNNNNNNCGW 1 cut(s) 393
PspN4I GGNNCC 2 cut(s) 6, 217
PspPI GGNCC 1 cut(s) 216
PsuI RGATCY 1 cut(s) 4
RsaI GTAC 1 cut(s) 42
RsaNI GTAC 1 cut(s) 41
SaqAI TTAA 3 cut(s) 69, 288, 441
Sau3AI GATC 5 cut(s) 4, 151, 316, 360, 405
Sau96I GGNCC 1 cut(s) 216
SetI ASST 6 cut(s) 42, 288, 306, 340, 348, 396
SfaNI GCATC 2 cut(s) 190, 262
SinI GGWCC 1 cut(s) 216
Sse9I AATT 4 cut(s) 16, 65, 125, 452
SseBI AGGCCT 1 cut(s) 296
SsiI CCGC 1 cut(s) 8
SspMI CTAG 1 cut(s) 368
StuI AGGCCT 1 cut(s) 296
TaaI ACNGT 3 cut(s) 107, 118, 136
TaqI TCGA 3 cut(s) 120, 309, 396
TasI AATT 4 cut(s) 16, 65, 125, 452
Tru1I TTAA 3 cut(s) 69, 288, 441
Tru9I TTAA 3 cut(s) 69, 288, 441
TspDTI ATGAA 1 cut(s) 275
TspGWI ACGGA 2 cut(s) 284, 398
VpaK11BI GGWCC 1 cut(s) 216
XapI RAATTY 3 cut(s) 16, 65, 452
XceI RCATGY 1 cut(s) 356
XspI CTAG 1 cut(s) 368
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.