Rmu_sc0004459.1_g000014

Calmodulin-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004459.1
Physical Location & Seq
Forward (+)
68015 .. 69737
1723 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004459.1_g000014.1.cds

Sequence Viewer

Length: 486 bp
atggcagaggtactaagtgaagaacagattgttgaatttaaagaggcattctgtctatttgacaaggatggagacggtgagtttcctactactatgtcctcaattcttggttgcataactgtcgaagaattggcgacagttatcaggtctctggatcaaaatccaacagaggaggaacttcaggatatgattagtgaagttgatgctgatggaaatgggaccatagagtttgcagagttcttgaacttgatggcaaacaaaatgaaggaaacggatgcagaggaggagcttaaagaggccttcaaggtattcgacaaggatcagaatggatatatatcagctaatgagctgaggcatgtaatgatcaatctaggagaaaaactgacagacgaagaggtcgagcagatgatcaaggaggccgatttggatggcgatggtcaagttaactatgacgaatttgtgaagatgatgatgaccattggatga

Protein Analysis

161

Amino Acids

18.19

Weight (kDa)

4.05

Isoelectric Point (pI)

45.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012718)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 395
AclWI GGATC 2 cut(s) 162, 327
AcsI RAATTY 2 cut(s) 35, 455
AcuI CTGAAG 1 cut(s) 164
AfaI GTAC 1 cut(s) 12
AgsI TTSAA 3 cut(s) 35, 244, 304
AluBI AGCT 3 cut(s) 289, 341, 349
AluI AGCT 3 cut(s) 289, 341, 349
Alw26I GTCTC 2 cut(s) 66, 153
AlwI GGATC 2 cut(s) 162, 327
AoxI GGCC 2 cut(s) 297, 417
ApoI RAATTY 2 cut(s) 35, 455
AspS9I GGNCC 1 cut(s) 219
AsuHPI GGTGA 1 cut(s) 89
AvaII GGWCC 1 cut(s) 219
BbvCI CCTCAGC 1 cut(s) 350
BccI CCATC 5 cut(s) 62, 203, 244, 422, 428
BcgI CGANNNNNNTGC 2 cut(s) 103, 137
BclI TGATCA 2 cut(s) 363, 408
BcoDI GTCTC 2 cut(s) 66, 153
BfaI CTAG 1 cut(s) 371
Bme18I GGWCC 1 cut(s) 219
BmgT120I GGNCC 1 cut(s) 219
BmiI GGNNCC 1 cut(s) 220
BmsI GCATC 2 cut(s) 193, 265
Bpu10I CCTNAGC 1 cut(s) 350
BsaBI GATNNNNATC 2 cut(s) 159, 334
BsaI GGTCTC 1 cut(s) 153
Bse8I GATNNNNATC 2 cut(s) 159, 334
BseGI GGATG 3 cut(s) 73, 280, 433
BseJI GATNNNNATC 2 cut(s) 159, 334
BseMII CTCAG 1 cut(s) 341
BseRI GAGGAG 3 cut(s) 185, 296, 299
BshFI GGCC 2 cut(s) 299, 419
BslFI GGGAC 1 cut(s) 232
BsmAI GTCTC 2 cut(s) 66, 153
BsmBI CGTCTC 1 cut(s) 66
BsmFI GGGAC 1 cut(s) 232
BsmI GAATGC 1 cut(s) 47
BsnI GGCC 2 cut(s) 299, 419
Bso31I GGTCTC 1 cut(s) 153
Bsp143I GATC 4 cut(s) 154, 319, 363, 408
BspANI GGCC 2 cut(s) 299, 419
BspCNI CTCAG 1 cut(s) 342
BspLI GGNNCC 1 cut(s) 220
BspPI GGATC 2 cut(s) 162, 327
BspTNI GGTCTC 1 cut(s) 153
BssMI GATC 4 cut(s) 154, 319, 363, 408
Bst4CI ACNGT 3 cut(s) 77, 121, 139
Bst6I CTCTTC 1 cut(s) 387
BstDEI CTNAG 2 cut(s) 14, 350
BstF5I GGATG 3 cut(s) 73, 280, 433
BstKTI GATC 4 cut(s) 157, 322, 366, 411
BstMAI GTCTC 2 cut(s) 66, 153
BstMBI GATC 4 cut(s) 154, 319, 363, 408
BstNSI RCATGY 1 cut(s) 359
BsuRI GGCC 2 cut(s) 299, 419
BtgZI GCGATG 1 cut(s) 447
BtsCI GGATG 3 cut(s) 73, 280, 433
Cfr13I GGNCC 1 cut(s) 219
Csp6I GTAC 1 cut(s) 11
CviAII CATG 1 cut(s) 356
CviJI RGCY 5 cut(s) 289, 299, 341, 349, 419
CviKI_1 RGCY 5 cut(s) 289, 299, 341, 349, 419
CviQI GTAC 1 cut(s) 11
DdeI CTNAG 2 cut(s) 14, 350
DpnI GATC 4 cut(s) 156, 321, 365, 410
DpnII GATC 4 cut(s) 154, 319, 363, 408
DraI TTTAAA 1 cut(s) 40
DrdI GACNNNNNNGTC 1 cut(s) 395
DseDI GACNNNNNNGTC 1 cut(s) 395
Eam1104I CTCTTC 1 cut(s) 387
EarI CTCTTC 1 cut(s) 387
Eco147I AGGCCT 1 cut(s) 299
Eco31I GGTCTC 1 cut(s) 153
Eco47I GGWCC 1 cut(s) 219
Eco57I CTGAAG 1 cut(s) 164
Esp3I CGTCTC 1 cut(s) 66
FaeI CATG 1 cut(s) 359
FaiI YATR 8 cut(s) 95, 116, 188, 224, 333, 335, 357, 450
FaqI GGGAC 1 cut(s) 232
FatI CATG 1 cut(s) 355
FbaI TGATCA 2 cut(s) 363, 408
FokI GGATG 3 cut(s) 80, 287, 440
FspBI CTAG 1 cut(s) 371
HaeIII GGCC 2 cut(s) 299, 419
Hin1II CATG 1 cut(s) 359
HincII GTYRAC 1 cut(s) 445
HindII GTYRAC 1 cut(s) 445
HpaI GTTAAC 1 cut(s) 445
HphI GGTGA 1 cut(s) 89
Hpy166II GTNNAC 1 cut(s) 445
Hpy188I TCNGA 1 cut(s) 324
Hpy188III TCNNGA 3 cut(s) 152, 182, 241
Hpy8I GTNNAC 1 cut(s) 445
HpyAV CCTTC 2 cut(s) 259, 310
HpyCH4III ACNGT 3 cut(s) 77, 121, 139
HpyCH4V TGCA 3 cut(s) 114, 233, 278
HpyF3I CTNAG 2 cut(s) 14, 350
Hsp92II CATG 1 cut(s) 359
Ksp22I TGATCA 2 cut(s) 363, 408
KspAI GTTAAC 1 cut(s) 445
Kzo9I GATC 4 cut(s) 154, 319, 363, 408
LmnI GCTCC 1 cut(s) 286
LpnPI CCDG 3 cut(s) 130, 137, 167
LweI GCATC 2 cut(s) 193, 265
MaeI CTAG 1 cut(s) 371
MalI GATC 4 cut(s) 156, 321, 365, 410
MboI GATC 4 cut(s) 154, 319, 363, 408
MboII GAAGA 4 cut(s) 32, 137, 404, 475
MluCI AATT 4 cut(s) 35, 102, 128, 455
MmeI TCCRAC 1 cut(s) 188
MseI TTAA 3 cut(s) 39, 291, 444
Mva1269I GAATGC 1 cut(s) 47
NdeII GATC 4 cut(s) 154, 319, 363, 408
NlaIII CATG 1 cut(s) 359
NlaIV GGNNCC 1 cut(s) 220
NspI RCATGY 1 cut(s) 359
PceI AGGCCT 1 cut(s) 299
PcsI WCGNNNNNNNCGW 1 cut(s) 396
PctI GAATGC 1 cut(s) 47
PspN4I GGNNCC 1 cut(s) 220
PspPI GGNCC 1 cut(s) 219
RsaI GTAC 1 cut(s) 12
RsaNI GTAC 1 cut(s) 11
SaqAI TTAA 3 cut(s) 39, 291, 444
Sau3AI GATC 4 cut(s) 154, 319, 363, 408
Sau96I GGNCC 1 cut(s) 219
SetI ASST 7 cut(s) 12, 149, 291, 309, 343, 351, 399
SfaNI GCATC 2 cut(s) 193, 265
SinI GGWCC 1 cut(s) 219
Sse9I AATT 4 cut(s) 35, 102, 128, 455
SseBI AGGCCT 1 cut(s) 299
SspMI CTAG 1 cut(s) 371
StuI AGGCCT 1 cut(s) 299
TaaI ACNGT 3 cut(s) 77, 121, 139
TaqI TCGA 3 cut(s) 123, 312, 399
TasI AATT 4 cut(s) 35, 102, 128, 455
Tru1I TTAA 3 cut(s) 39, 291, 444
Tru9I TTAA 3 cut(s) 39, 291, 444
TspDTI ATGAA 1 cut(s) 278
TspGWI ACGGA 1 cut(s) 287
VpaK11BI GGWCC 1 cut(s) 219
XapI RAATTY 2 cut(s) 35, 455
XceI RCATGY 1 cut(s) 359
XspI CTAG 1 cut(s) 371
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.