AT3G53342

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Forward (+)
19777087 .. 19777353
267 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G53342.1

Sequence Viewer

Length: 219 bp
ATGGTAAGTTTCGGGAATTACTTCGAGAGGTTGCCTGTGAAGCTTCCTAATAACCGCCATGTGGAGAAGGAGAAGAAGAAGGAGGTGAAAGAAGAGGAGGTGGAGAATTGGGGGCTTAGAGAGTTGATCGATGGTGGTGACGTTGCTCCTGGTAGGATTCTTCATAGGAACAACATTAACATCGGTTCCTCAAGGTTTGTTTCTTACAACTCCTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

8.39

Weight (kDa)

8.08

Isoelectric Point (pI)

52.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 55
AfiI CCNNNNNNNGG 1 cut(s) 61
AjnI CCWGG 1 cut(s) 148
AluBI AGCT 1 cut(s) 43
AluI AGCT 1 cut(s) 43
Asp700I GAANNNNTTC 1 cut(s) 20
AsuHPI GGTGA 2 cut(s) 97, 149
BccI CCATC 1 cut(s) 125
BciT130I CCWGG 1 cut(s) 150
Bme1390I CCNGG 1 cut(s) 150
BmiI GGNNCC 1 cut(s) 187
BmrFI CCNGG 1 cut(s) 150
BpuEI CTTGAG 1 cut(s) 175
Bsa29I ATCGAT 1 cut(s) 129
Bsc4I CCNNNNNNNGG 1 cut(s) 61
BseBI CCWGG 1 cut(s) 150
BseCI ATCGAT 1 cut(s) 129
BseLI CCNNNNNNNGG 1 cut(s) 61
BseRI GAGGAG 1 cut(s) 110
BshVI ATCGAT 1 cut(s) 129
BslI CCNNNNNNNGG 1 cut(s) 61
Bsp143I GATC 1 cut(s) 126
BspACI CCGC 1 cut(s) 55
BspDI ATCGAT 1 cut(s) 129
BspLI GGNNCC 1 cut(s) 187
BssMI GATC 1 cut(s) 126
Bst2UI CCWGG 1 cut(s) 150
Bst6I CTCTTC 1 cut(s) 87
BstDEI CTNAG 1 cut(s) 116
BstKTI GATC 1 cut(s) 129
BstMBI GATC 1 cut(s) 126
BstMWI GCNNNNNNNGC 1 cut(s) 40
BstNI CCWGG 1 cut(s) 150
BstSCI CCNGG 1 cut(s) 148
Bsu15I ATCGAT 1 cut(s) 129
BsuTUI ATCGAT 1 cut(s) 129
ClaI ATCGAT 1 cut(s) 129
CviAII CATG 1 cut(s) 59
CviJI RGCY 2 cut(s) 43, 115
CviKI_1 RGCY 2 cut(s) 43, 115
DdeI CTNAG 1 cut(s) 116
DpnI GATC 1 cut(s) 128
DpnII GATC 1 cut(s) 126
Eam1104I CTCTTC 1 cut(s) 87
EarI CTCTTC 1 cut(s) 87
EcoRII CCWGG 1 cut(s) 148
FaeI CATG 1 cut(s) 62
FaiI YATR 2 cut(s) 60, 165
FatI CATG 1 cut(s) 58
Hin1II CATG 1 cut(s) 62
HindIII AAGCTT 1 cut(s) 41
HinfI GANTC 1 cut(s) 157
HphI GGTGA 2 cut(s) 97, 149
Hpy188III TCNNGA 2 cut(s) 13, 25
HpyAV CCTTC 2 cut(s) 61, 73
HpyCH4IV ACGT 1 cut(s) 141
HpyF10VI GCNNNNNNNGC 1 cut(s) 40
HpyF3I CTNAG 1 cut(s) 116
HpySE526I ACGT 1 cut(s) 141
Hsp92II CATG 1 cut(s) 62
Kzo9I GATC 1 cut(s) 126
LmnI GCTCC 1 cut(s) 151
LpnPI CCDG 3 cut(s) 48, 135, 162
MaeII ACGT 1 cut(s) 141
MaeIII GTNAC 1 cut(s) 137
MalI GATC 1 cut(s) 128
MboI GATC 1 cut(s) 126
MboII GAAGA 4 cut(s) 85, 88, 104, 152
MluCI AATT 2 cut(s) 16, 106
MnlI CCTC 5 cut(s) 21, 76, 88, 91, 199
MroXI GAANNNNTTC 1 cut(s) 20
MseI TTAA 2 cut(s) 177, 217
MspR9I CCNGG 1 cut(s) 150
MvaI CCWGG 1 cut(s) 150
MwoI GCNNNNNNNGC 1 cut(s) 40
NdeII GATC 1 cut(s) 126
NlaIII CATG 1 cut(s) 62
NlaIV GGNNCC 1 cut(s) 187
NmuCI GTSAC 1 cut(s) 137
PdmI GAANNNNTTC 1 cut(s) 20
PfeI GAWTC 1 cut(s) 157
Psp6I CCWGG 1 cut(s) 148
PspGI CCWGG 1 cut(s) 148
PspN4I GGNNCC 1 cut(s) 187
SaqAI TTAA 2 cut(s) 177, 217
Sau3AI GATC 1 cut(s) 126
ScrFI CCNGG 1 cut(s) 150
SetI ASST 6 cut(s) 32, 45, 87, 102, 144, 197
SgeI CNNG 7 cut(s) 25, 37, 47, 71, 161, 162, 204
SmlI CTYRAG 1 cut(s) 190
SmoI CTYRAG 1 cut(s) 190
Sse9I AATT 2 cut(s) 16, 106
SsiI CCGC 1 cut(s) 55
StyD4I CCNGG 1 cut(s) 148
TaiI ACGT 1 cut(s) 144
TaqI TCGA 2 cut(s) 24, 129
TasI AATT 2 cut(s) 16, 106
TfiI GAWTC 1 cut(s) 157
Tru1I TTAA 2 cut(s) 177, 217
Tru9I TTAA 2 cut(s) 177, 217
TseFI GTSAC 1 cut(s) 137
Tsp45I GTSAC 1 cut(s) 137
TspDTI ATGAA 1 cut(s) 152
XmnI GAANNNNTTC 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.