AT4G10910

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
4
OG0010034
Physical Location & Seq
Forward (+)
6696712 .. 6697455
744 bp
Loading structure...
UTR
Exon/CDS
Intron
AT4G10910.1

Sequence Viewer

Length: 411 bp
ATGGGGAATTGTTCGCAAAGAGCAGTATCTGATGGTGGTGGTTCGGTTACCGTAATTGCGACAAATTCAAGAAACATCCTGGAAGAGTATTACAGAAGCCGGAGATGTAGCTCGTTGCCAATAACAAGGGAGAAAACACTAGGGTATCTTGTTAGACAAGGTACAACAAGCCCTAGAGGAGTACTTGGGCCAAGGATACAAGTGTCGCCGCAAAGAAGAAATGGAGTTTGGAAAGCGAAAGTGGTGATCGGAAGTAAGCAGCTTGAAGAGATTTTGGCAGTTGAAGGCAATACACACGCTTTGATTGATCAGCTCCGGTTTGCTGCAGCAGAAGCTTTAGTTTCTTCAACCTCCGCCTCTGAGATGGTCAGAGTTAAAAGTTTATTGTCCAAGTCCCGAAAAAGACAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4228

Protein Analysis

136

Amino Acids

14.87

Weight (kDa)

10.7

Isoelectric Point (pI)

55.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 209, 354
AcsI RAATTY 1 cut(s) 64
AfaI GTAC 2 cut(s) 163, 183
AgsI TTSAA 4 cut(s) 69, 266, 284, 348
AjnI CCWGG 1 cut(s) 78
AjuI GAANNNNNNNTTGG 2 cut(s) 211, 243
AluBI AGCT 4 cut(s) 111, 262, 313, 335
AluI AGCT 4 cut(s) 111, 262, 313, 335
AlwNI CAGNNNCTG 1 cut(s) 29
AoxI GGCC 1 cut(s) 188
ApeKI GCWGC 3 cut(s) 259, 323, 326
ApoI RAATTY 1 cut(s) 64
AspS9I GGNCC 1 cut(s) 188
AsuHPI GGTGA 1 cut(s) 256
BaeI ACNNNNGTAYC 4 cut(s) 128, 161, 188, 221
BbvI GCAGC 3 cut(s) 271, 310, 338
BccI CCATC 2 cut(s) 26, 358
BciT130I CCWGG 1 cut(s) 80
BciVI GTATCC 1 cut(s) 189
BclI TGATCA 1 cut(s) 307
BfaI CTAG 2 cut(s) 140, 174
BfmI CTRYAG 1 cut(s) 324
BfuI GTATCC 1 cut(s) 189
BisI GCNGC 4 cut(s) 209, 260, 324, 327
BlsI GCNGC 4 cut(s) 210, 261, 325, 328
BmcAI AGTACT 1 cut(s) 183
Bme1390I CCNGG 1 cut(s) 80
BmgT120I GGNCC 1 cut(s) 188
BmrFI CCNGG 1 cut(s) 80
BsaJI CCNNGG 1 cut(s) 191
BsaWI WCCGGW 1 cut(s) 315
BseBI CCWGG 1 cut(s) 80
BseDI CCNNGG 1 cut(s) 191
BseGI GGATG 1 cut(s) 75
BseMII CTCAG 1 cut(s) 351
BseRI GAGGAG 1 cut(s) 192
BseXI GCAGC 3 cut(s) 271, 310, 338
BshFI GGCC 1 cut(s) 190
BsiSI CCGG 2 cut(s) 100, 316
BslFI GGGAC 1 cut(s) 379
BsmFI GGGAC 1 cut(s) 379
BsnI GGCC 1 cut(s) 190
Bsp143I GATC 2 cut(s) 246, 307
BspACI CCGC 2 cut(s) 209, 354
BspANI GGCC 1 cut(s) 190
BspCNI CTCAG 1 cut(s) 352
BspMAI CTGCAG 1 cut(s) 328
BssECI CCNNGG 1 cut(s) 191
BssMI GATC 2 cut(s) 246, 307
BssT1I CCWWGG 1 cut(s) 191
Bst2UI CCWGG 1 cut(s) 80
Bst4CI ACNGT 1 cut(s) 52
Bst6I CTCTTC 2 cut(s) 78, 261
BstDEI CTNAG 1 cut(s) 360
BstEII GGTNACC 1 cut(s) 46
BstF5I GGATG 1 cut(s) 75
BstKTI GATC 2 cut(s) 249, 310
BstMBI GATC 2 cut(s) 246, 307
BstMWI GCNNNNNNNGC 1 cut(s) 332
BstNI CCWGG 1 cut(s) 80
BstPI GGTNACC 1 cut(s) 46
BstSCI CCNGG 1 cut(s) 78
BstSFI CTRYAG 1 cut(s) 324
BstV1I GCAGC 3 cut(s) 271, 310, 338
BsuI GTATCC 1 cut(s) 189
BsuRI GGCC 1 cut(s) 190
BtsCI GGATG 1 cut(s) 75
CaiI CAGNNNCTG 1 cut(s) 29
Cfr13I GGNCC 1 cut(s) 188
Csp6I GTAC 2 cut(s) 162, 182
CviJI RGCY 7 cut(s) 99, 111, 171, 190, 262, 313, 335
CviKI_1 RGCY 7 cut(s) 99, 111, 171, 190, 262, 313, 335
CviQI GTAC 2 cut(s) 162, 182
DdeI CTNAG 1 cut(s) 360
DpnI GATC 2 cut(s) 248, 309
DpnII GATC 2 cut(s) 246, 307
Eam1104I CTCTTC 2 cut(s) 78, 261
EarI CTCTTC 2 cut(s) 78, 261
EciI GGCGGA 1 cut(s) 343
Eco130I CCWWGG 1 cut(s) 191
Eco91I GGTNACC 1 cut(s) 46
EcoO65I GGTNACC 1 cut(s) 46
EcoRII CCWGG 1 cut(s) 78
EcoT14I CCWWGG 1 cut(s) 191
ErhI CCWWGG 1 cut(s) 191
FaqI GGGAC 1 cut(s) 379
FbaI TGATCA 1 cut(s) 307
Fnu4HI GCNGC 4 cut(s) 209, 260, 324, 327
FokI GGATG 1 cut(s) 62
Fsp4HI GCNGC 4 cut(s) 209, 260, 324, 327
FspBI CTAG 2 cut(s) 140, 174
GluI GCNGC 4 cut(s) 209, 260, 324, 327
HaeIII GGCC 1 cut(s) 190
HapII CCGG 2 cut(s) 100, 316
HindIII AAGCTT 1 cut(s) 333
HpaII CCGG 2 cut(s) 100, 316
HphI GGTGA 1 cut(s) 256
Hpy188I TCNGA 4 cut(s) 31, 251, 361, 371
Hpy188III TCNNGA 2 cut(s) 69, 396
HpyAV CCTTC 1 cut(s) 278
HpyCH4III ACNGT 1 cut(s) 52
HpyCH4V TGCA 1 cut(s) 326
HpyF10VI GCNNNNNNNGC 1 cut(s) 332
HpyF3I CTNAG 1 cut(s) 360
Ksp22I TGATCA 1 cut(s) 307
Kzo9I GATC 2 cut(s) 246, 307
LmnI GCTCC 1 cut(s) 318
LpnPI CCDG 4 cut(s) 65, 92, 113, 329
Lsp1109I GCAGC 3 cut(s) 271, 310, 338
MaeI CTAG 2 cut(s) 140, 174
MaeIII GTNAC 1 cut(s) 46
MalI GATC 2 cut(s) 248, 309
MboI GATC 2 cut(s) 246, 307
MboII GAAGA 4 cut(s) 95, 228, 278, 336
MluCI AATT 3 cut(s) 7, 54, 64
MnlI CCTC 3 cut(s) 170, 361, 367
MseI TTAA 1 cut(s) 375
MspI CCGG 2 cut(s) 100, 316
MspR9I CCNGG 1 cut(s) 80
MvaI CCWGG 1 cut(s) 80
MwoI GCNNNNNNNGC 1 cut(s) 332
NdeII GATC 2 cut(s) 246, 307
PfoI TCCNGGA 1 cut(s) 78
PkrI GCNGC 4 cut(s) 210, 261, 325, 328
Psp6I CCWGG 1 cut(s) 78
PspEI GGTNACC 1 cut(s) 46
PspGI CCWGG 1 cut(s) 78
PspPI GGNCC 1 cut(s) 188
PstI CTGCAG 1 cut(s) 328
PstNI CAGNNNCTG 1 cut(s) 29
RsaI GTAC 2 cut(s) 163, 183
RsaNI GTAC 2 cut(s) 162, 182
SaqAI TTAA 1 cut(s) 375
SatI GCNGC 4 cut(s) 209, 260, 324, 327
Sau3AI GATC 2 cut(s) 246, 307
Sau96I GGNCC 1 cut(s) 188
ScaI AGTACT 1 cut(s) 183
ScrFI CCNGG 1 cut(s) 80
SetI ASST 6 cut(s) 113, 163, 264, 315, 337, 353
SfcI CTRYAG 1 cut(s) 324
Sse9I AATT 3 cut(s) 7, 54, 64
SsiI CCGC 2 cut(s) 209, 354
SspMI CTAG 2 cut(s) 140, 174
StyD4I CCNGG 1 cut(s) 78
StyI CCWWGG 1 cut(s) 191
TaaI ACNGT 1 cut(s) 52
TasI AATT 3 cut(s) 7, 54, 64
TatI WGTACW 1 cut(s) 181
TauI GCSGC 1 cut(s) 211
Tru1I TTAA 1 cut(s) 375
Tru9I TTAA 1 cut(s) 375
TseI GCWGC 3 cut(s) 259, 323, 326
XapI RAATTY 1 cut(s) 64
XspI CTAG 2 cut(s) 140, 174
ZrmI AGTACT 1 cut(s) 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.