Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0009433.1

Orthogroup ID

OG0010034

Physical Location & Seq

Genomic Coordinates Forward (+)

29918 .. 30586

Gene Structure 669 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0009433.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 669 bp

atgggaaattgctcttctctcaaaggaacctgtggggagtgtcgtaactctatcagggtccttacagattctgggggtatcctacagtttaaaggtcctaagttagcttcggaaatcctcgctggttttccaggctatggcatttttcagcagggcaaggcctcggtgccattgcctgaggaagaggccttaactagtggccagttctaccttcttccactgaggactaaagaggaagtgcctgctgattatggggtctctgtagaagttcaagaaatgggtgctgatgaagatttggatggtgcagaagaagctgagccggtgaagaagtcgtttgggggtgcatcggattgcgtggagaatttggcaaatgggtcaggaggaggtctggaagtaatgccgtgtggaggagatggggtttggagagtgaagcttgtgattgacactaagcagttagaggagatattgtctgaaggcaacactctggctctgatagagatgatgaggatggctgcaacagcaagtgctacaccgaagctgcagagtaagagcctatggggttcaggaggaggtgggggttggaattggaagcctatcttctccaacatgtttaaggcccccacggccataactgcccctatggccgtaactgatcaaagtgggatgtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF4228

Protein Analysis

222

Amino Acids

23.27

Weight (kDa)

4.6

Isoelectric Point (pI)

46.96

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010034)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G10910
fragaria_vesca	FvH4_5g04950
malus_domestica	MD06G1110100.v1.1 MD14G1131100.v1.1
prunus_persica	Prupe.5G123000_v2.0.a1
rosa_chinensis	RchiOBHm_Chr7g0194121
rosa_laevigata	RLG00000004095 RLG00000004216
rosa_multiflora	Rmu_co8264105.1_g000001 Rmu_sc0003314.1_g000019 Rmu_sc0003468.1_g000002 Rmu_sc0009433.1_g000005
rosa_roxburghii	Rroxscaffold_3G00261540
rosa_rugosa	Rorug07G0013900
rosa_samantha	Rh7AG141000 Rh7BG141700 Rh7BG155000 Rh7BG155200 Rh7CG145100 Rh7DG142500
rosa_wichuraiana	Rw7G012060

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	166
AccB7I	CCANNNNNTGG	1 cut(s)	137
AcoI	YGGCCR	3 cut(s)	199, 624, 642
AcsI	RAATTY	1 cut(s)	361
AcuI	CTGAAG	1 cut(s)	492
AfiI	CCNNNNNNNGG	2 cut(s)	137, 407
AflIII	ACRYGT	1 cut(s)	606
AgsI	TTSAA	1 cut(s)	272
AhlI	ACTAGT	1 cut(s)	194
AjnI	CCWGG	1 cut(s)	130
AluBI	AGCT	4 cut(s)	107, 314, 433, 538
AluI	AGCT	4 cut(s)	107, 314, 433, 538
Alw26I	GTCTC	1 cut(s)	262
AlwNI	CAGNNNCTG	1 cut(s)	71
AoxI	GGCC	6 cut(s)	159, 186, 199, 615, 624, 642
ApeKI	GCWGC	2 cut(s)	512, 538
ApoI	RAATTY	1 cut(s)	361
AspS9I	GGNCC	3 cut(s)	58, 95, 616
AsuHPI	GGTGA	1 cut(s)	334
AvaII	GGWCC	2 cut(s)	58, 95
AxyI	CCTNAGG	1 cut(s)	177
BalI	TGGCCA	1 cut(s)	201
BanI	GGYRCC	1 cut(s)	166
BbvI	GCAGC	2 cut(s)	499, 525
BccI	CCATC	3 cut(s)	293, 407, 502
BceAI	ACGGC	3 cut(s)	385, 629, 639
BciT130I	CCWGG	1 cut(s)	132
BciVI	GTATCC	1 cut(s)	89
BclI	TGATCA	1 cut(s)	652
BcoDI	GTCTC	1 cut(s)	262
BcuI	ACTAGT	1 cut(s)	194
BfaI	CTAG	1 cut(s)	195
BfmI	CTRYAG	3 cut(s)	83, 261, 539
BfuI	GTATCC	1 cut(s)	89
BglI	GCCNNNNNGGC	2 cut(s)	623, 641
BisI	GCNGC	2 cut(s)	513, 539
BlpI	GCTNAGC	1 cut(s)	315
BlsI	GCNGC	2 cut(s)	514, 540
Bme1390I	CCNGG	1 cut(s)	132
Bme18I	GGWCC	2 cut(s)	58, 95
BmgT120I	GGNCC	3 cut(s)	58, 95, 616
BmiI	GGNNCC	4 cut(s)	28, 59, 168, 618
BmrFI	CCNGG	1 cut(s)	132
BmsI	GCATC	1 cut(s)	353
Bpu1102I	GCTNAGC	1 cut(s)	315
BsaI	GGTCTC	1 cut(s)	262
BsaJI	CCNNGG	2 cut(s)	162, 621
BsaXI	ACNNNNNCTCC	4 cut(s)	402, 432, 452, 482
Bsc4I	CCNNNNNNNGG	2 cut(s)	137, 407
Bse118I	RCCGGY	1 cut(s)	319
Bse1I	ACTGG	1 cut(s)	202
Bse21I	CCTNAGG	1 cut(s)	177
Bse3DI	GCAATG	1 cut(s)	170
BseBI	CCWGG	1 cut(s)	132
BseDI	CCNNGG	2 cut(s)	162, 621
BseGI	GGATG	3 cut(s)	304, 513, 669
BseLI	CCNNNNNNNGG	2 cut(s)	137, 407
BseMI	GCAATG	1 cut(s)	170
BseMII	CTCAG	3 cut(s)	168, 212, 306
BseNI	ACTGG	1 cut(s)	202
BseRI	GAGGAG	4 cut(s)	396, 423, 473, 582
BseXI	GCAGC	2 cut(s)	499, 525
BsgI	GTGCAG	1 cut(s)	324
BshFI	GGCC	6 cut(s)	161, 188, 201, 617, 626, 644
BshNI	GGYRCC	1 cut(s)	166
BsiSI	CCGG	1 cut(s)	320
BslI	CCNNNNNNNGG	2 cut(s)	137, 407
BsmAI	GTCTC	1 cut(s)	262
BsnI	GGCC	6 cut(s)	161, 188, 201, 617, 626, 644
Bso31I	GGTCTC	1 cut(s)	262
Bsp143I	GATC	1 cut(s)	652
Bsp1720I	GCTNAGC	1 cut(s)	315
BspANI	GGCC	6 cut(s)	161, 188, 201, 617, 626, 644
BspCNI	CTCAG	3 cut(s)	169, 213, 307
BspLI	GGNNCC	4 cut(s)	28, 59, 168, 618
BspMAI	CTGCAG	1 cut(s)	543
BspQI	GCTCTTC	1 cut(s)	19
BspT107I	GGYRCC	1 cut(s)	166
BspTNI	GGTCTC	1 cut(s)	262
BsrDI	GCAATG	1 cut(s)	170
BsrFI	RCCGGY	1 cut(s)	319
BsrI	ACTGG	1 cut(s)	202
BssAI	RCCGGY	1 cut(s)	319
BssECI	CCNNGG	2 cut(s)	162, 621
BssMI	GATC	1 cut(s)	652
Bst2UI	CCWGG	1 cut(s)	132
Bst4CI	ACNGT	1 cut(s)	87
Bst6I	CTCTTC	2 cut(s)	19, 177
BstC8I	GCNNGC	1 cut(s)	243
BstDEI	CTNAG	5 cut(s)	99, 177, 221, 315, 447
BstDSI	CCRYGG	1 cut(s)	621
BstF5I	GGATG	3 cut(s)	304, 513, 669
BstKTI	GATC	1 cut(s)	655
BstMAI	GTCTC	1 cut(s)	262
BstMBI	GATC	1 cut(s)	652
BstMWI	GCNNNNNNNGC	5 cut(s)	311, 518, 623, 632, 641
BstNI	CCWGG	1 cut(s)	132
BstNSI	RCATGY	1 cut(s)	610
BstSCI	CCNGG	1 cut(s)	130
BstSFI	CTRYAG	3 cut(s)	83, 261, 539
BstV1I	GCAGC	2 cut(s)	499, 525
Bsu36I	CCTNAGG	1 cut(s)	177
BsuI	GTATCC	1 cut(s)	89
BsuRI	GGCC	6 cut(s)	161, 188, 201, 617, 626, 644
BtgI	CCRYGG	1 cut(s)	621
BtsCI	GGATG	3 cut(s)	304, 513, 669
BtsIMutI	CAGTG	1 cut(s)	218
Cac8I	GCNNGC	1 cut(s)	243
CaiI	CAGNNNCTG	1 cut(s)	71
Cfr10I	RCCGGY	1 cut(s)	319
Cfr13I	GGNCC	3 cut(s)	58, 95, 616
CviAII	CATG	1 cut(s)	607
DdeI	CTNAG	5 cut(s)	99, 177, 221, 315, 447
DpnI	GATC	1 cut(s)	654
DpnII	GATC	1 cut(s)	652
DraI	TTTAAA	1 cut(s)	91
EaeI	YGGCCR	3 cut(s)	199, 624, 642
Eam1104I	CTCTTC	2 cut(s)	19, 177
EarI	CTCTTC	2 cut(s)	19, 177
Eco147I	AGGCCT	2 cut(s)	161, 188
Eco31I	GGTCTC	1 cut(s)	262
Eco47I	GGWCC	2 cut(s)	58, 95
Eco57I	CTGAAG	1 cut(s)	492
Eco81I	CCTNAGG	1 cut(s)	177
EcoO109I	RGGNCCY	3 cut(s)	58, 95, 616
EcoRII	CCWGG	1 cut(s)	130
FaeI	CATG	1 cut(s)	610
FaiI	YATR	6 cut(s)	138, 252, 556, 608, 629, 641
FalI	AAGNNNNNCTT	2 cut(s)	581, 613
FatI	CATG	1 cut(s)	606
FbaI	TGATCA	1 cut(s)	652
Fnu4HI	GCNGC	2 cut(s)	513, 539
FokI	GGATG	2 cut(s)	311, 520
Fsp4HI	GCNGC	2 cut(s)	513, 539
FspBI	CTAG	1 cut(s)	195
GluI	GCNGC	2 cut(s)	513, 539
HaeIII	GGCC	6 cut(s)	161, 188, 201, 617, 626, 644
HapII	CCGG	1 cut(s)	320
Hin1II	CATG	1 cut(s)	610
HindIII	AAGCTT	1 cut(s)	431
HinfI	GANTC	1 cut(s)	68
HpaII	CCGG	1 cut(s)	320
HphI	GGTGA	1 cut(s)	334
Hpy188I	TCNGA	4 cut(s)	112, 349, 472, 492
Hpy188III	TCNNGA	4 cut(s)	272, 378, 389, 564
HpyAV	CCTTC	2 cut(s)	221, 467
HpyCH4III	ACNGT	1 cut(s)	87
HpyCH4V	TGCA	4 cut(s)	305, 344, 515, 541
HpyF10VI	GCNNNNNNNGC	5 cut(s)	311, 518, 623, 632, 641
HpyF3I	CTNAG	5 cut(s)	99, 177, 221, 315, 447
Hsp92II	CATG	1 cut(s)	610
Ksp22I	TGATCA	1 cut(s)	652
Kzo9I	GATC	1 cut(s)	652
LguI	GCTCTTC	1 cut(s)	19
Lsp1109I	GCAGC	2 cut(s)	499, 525
LweI	GCATC	1 cut(s)	353
MaeI	CTAG	1 cut(s)	195
MaeIII	GTNAC	2 cut(s)	44, 646
MalI	GATC	1 cut(s)	654
MboI	GATC	1 cut(s)	652
MboII	GAAGA	7 cut(s)	6, 194, 206, 302, 320, 337, 589
MlsI	TGGCCA	1 cut(s)	201
MluCI	AATT	3 cut(s)	7, 361, 583
MluNI	TGGCCA	1 cut(s)	201
MmeI	TCCRAC	2 cut(s)	560, 627
Mox20I	TGGCCA	1 cut(s)	201
MscI	TGGCCA	1 cut(s)	201
MseI	TTAA	3 cut(s)	90, 191, 612
Msp20I	TGGCCA	1 cut(s)	201
MspI	CCGG	1 cut(s)	320
MspR9I	CCNGG	1 cut(s)	132
MvaI	CCWGG	1 cut(s)	132
MwoI	GCNNNNNNNGC	5 cut(s)	311, 518, 623, 632, 641
NdeII	GATC	1 cut(s)	652
NlaIII	CATG	1 cut(s)	610
NlaIV	GGNNCC	4 cut(s)	28, 59, 168, 618
NspI	RCATGY	1 cut(s)	610
PceI	AGGCCT	2 cut(s)	161, 188
PciI	ACATGT	1 cut(s)	606
PciSI	GCTCTTC	1 cut(s)	19
PfeI	GAWTC	1 cut(s)	68
PflMI	CCANNNNNTGG	1 cut(s)	137
PkrI	GCNGC	2 cut(s)	514, 540
PpuMI	RGGWCCY	2 cut(s)	58, 95
PscI	ACATGT	1 cut(s)	606
Psp5II	RGGWCCY	2 cut(s)	58, 95
Psp6I	CCWGG	1 cut(s)	130
PspGI	CCWGG	1 cut(s)	130
PspN4I	GGNNCC	4 cut(s)	28, 59, 168, 618
PspPI	GGNCC	3 cut(s)	58, 95, 616
PspPPI	RGGWCCY	2 cut(s)	58, 95
PstI	CTGCAG	1 cut(s)	543
PstNI	CAGNNNCTG	1 cut(s)	71
SapI	GCTCTTC	1 cut(s)	19
SaqAI	TTAA	3 cut(s)	90, 191, 612
SatI	GCNGC	2 cut(s)	513, 539
Sau3AI	GATC	1 cut(s)	652
Sau96I	GGNCC	3 cut(s)	58, 95, 616
ScrFI	CCNGG	1 cut(s)	132
SetI	ASST	9 cut(s)	32, 97, 109, 213, 316, 388, 435, 540, 574
SfaNI	GCATC	1 cut(s)	353
SfcI	CTRYAG	3 cut(s)	83, 261, 539
SfiI	GGCCNNNNNGGCC	1 cut(s)	623
SinI	GGWCC	2 cut(s)	58, 95
SpeI	ACTAGT	1 cut(s)	194
Sse9I	AATT	3 cut(s)	7, 361, 583
SseBI	AGGCCT	2 cut(s)	161, 188
SspMI	CTAG	1 cut(s)	195
StuI	AGGCCT	2 cut(s)	161, 188
StyD4I	CCNGG	1 cut(s)	130
TaaI	ACNGT	1 cut(s)	87
TasI	AATT	3 cut(s)	7, 361, 583
TfiI	GAWTC	1 cut(s)	68
Tru1I	TTAA	3 cut(s)	90, 191, 612
Tru9I	TTAA	3 cut(s)	90, 191, 612
TscAI	CASTG	1 cut(s)	225
TseI	GCWGC	2 cut(s)	512, 538
TspDTI	ATGAA	1 cut(s)	303
TspRI	CASTG	1 cut(s)	225
Van91I	CCANNNNNTGG	1 cut(s)	137
VpaK11BI	GGWCC	2 cut(s)	58, 95
XapI	RAATTY	1 cut(s)	361
XceI	RCATGY	1 cut(s)	610
XspI	CTAG	1 cut(s)	195

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.