AT4G26055

Domain of unknown function (DUF4516)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
4
OG0010944
Physical Location & Seq
Reverse (-)
13213769 .. 13214509
741 bp
Loading structure...
UTR
Exon/CDS
Intron
AT4G26055.1

Sequence Viewer

Length: 189 bp
ATGAACAATAAATTTGGCGGGAAGAAGCCGACGGGAACACCGTCACTAGCGTGGTCGACAGTCGTAGTTGTAGCCTCTCTGCTCGCCGGAGCCTCCGTCGTTCACAATATATACAAGCCAGATCTCACATTACCTCAGATCGAAAACGATGAAGGAGACGAGAAGGAGGAGTCTGCAAACAAAGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4516

Protein Analysis

62

Amino Acids

6.55

Weight (kDa)

5.12

Isoelectric Point (pI)

44.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF4516 PF14990 9 - 52 7.9e-21 Domain of unknown function (DUF4516)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 56
AciI CCGC 1 cut(s) 18
AcsI RAATTY 1 cut(s) 11
AleI CACNNNNGTG 1 cut(s) 49
Alw26I GTCTC 1 cut(s) 150
ApoI RAATTY 1 cut(s) 11
BcoDI GTCTC 1 cut(s) 150
BfaI CTAG 1 cut(s) 47
BglII AGATCT 1 cut(s) 121
BmiI GGNNCC 1 cut(s) 91
BsaXI ACNNNNNCTCC 2 cut(s) 81, 111
BseMII CTCAG 1 cut(s) 149
BseRI GAGGAG 1 cut(s) 182
BsiSI CCGG 1 cut(s) 87
BsmAI GTCTC 1 cut(s) 150
BsmBI CGTCTC 1 cut(s) 150
Bsp143I GATC 2 cut(s) 121, 138
BspACI CCGC 1 cut(s) 18
BspCNI CTCAG 1 cut(s) 148
BspLI GGNNCC 1 cut(s) 91
BssMI GATC 2 cut(s) 121, 138
Bst4CI ACNGT 2 cut(s) 42, 61
BstC8I GCNNGC 1 cut(s) 84
BstDEI CTNAG 1 cut(s) 135
BstKTI GATC 2 cut(s) 124, 141
BstMAI GTCTC 1 cut(s) 150
BstMBI GATC 2 cut(s) 121, 138
BstX2I RGATCY 1 cut(s) 121
BstYI RGATCY 1 cut(s) 121
Cac8I GCNNGC 1 cut(s) 84
CviJI RGCY 4 cut(s) 28, 74, 92, 118
CviKI_1 RGCY 4 cut(s) 28, 74, 92, 118
DdeI CTNAG 1 cut(s) 135
DpnI GATC 2 cut(s) 123, 140
DpnII GATC 2 cut(s) 121, 138
Esp3I CGTCTC 1 cut(s) 150
FaiI YATR 2 cut(s) 110, 112
FauI CCCGC 1 cut(s) 11
FblI GTMKAC 1 cut(s) 56
FspBI CTAG 1 cut(s) 47
HapII CCGG 1 cut(s) 87
HincII GTYRAC 1 cut(s) 57
HindII GTYRAC 1 cut(s) 57
HinfI GANTC 1 cut(s) 170
HpaII CCGG 1 cut(s) 87
Hpy166II GTNNAC 2 cut(s) 57, 103
Hpy188I TCNGA 1 cut(s) 138
Hpy8I GTNNAC 2 cut(s) 57, 103
Hpy99I CGWCG 2 cut(s) 34, 101
HpyAV CCTTC 2 cut(s) 146, 157
HpyCH4III ACNGT 2 cut(s) 42, 61
HpyCH4V TGCA 1 cut(s) 176
HpyF3I CTNAG 1 cut(s) 135
Kzo9I GATC 2 cut(s) 121, 138
LmnI GCTCC 1 cut(s) 89
LpnPI CCDG 2 cut(s) 100, 132
MaeI CTAG 1 cut(s) 47
MaeIII GTNAC 1 cut(s) 42
MalI GATC 2 cut(s) 123, 140
MboI GATC 2 cut(s) 121, 138
MboII GAAGA 1 cut(s) 34
MflI RGATCY 1 cut(s) 121
MluCI AATT 1 cut(s) 11
MlyI GAGTC 1 cut(s) 179
MnlI CCTC 4 cut(s) 85, 103, 144, 160
MseI TTAA 1 cut(s) 187
MslI CAYNNNNRTG 1 cut(s) 49
MspI CCGG 1 cut(s) 87
NdeII GATC 2 cut(s) 121, 138
NlaIV GGNNCC 1 cut(s) 91
NmuCI GTSAC 1 cut(s) 42
OliI CACNNNNGTG 1 cut(s) 49
PcsI WCGNNNNNNNCGW 1 cut(s) 38
PleI GAGTC 1 cut(s) 178
PpsI GAGTC 1 cut(s) 178
PspN4I GGNNCC 1 cut(s) 91
PsuI RGATCY 1 cut(s) 121
RseI CAYNNNNRTG 1 cut(s) 49
SalI GTCGAC 1 cut(s) 55
SaqAI TTAA 1 cut(s) 187
Sau3AI GATC 2 cut(s) 121, 138
SchI GAGTC 1 cut(s) 179
SetI ASST 2 cut(s) 136, 187
SgeI CNNG 9 cut(s) 31, 45, 59, 63, 95, 99, 127, 131, 172
SmiMI CAYNNNNRTG 1 cut(s) 49
Sse9I AATT 1 cut(s) 11
SsiI CCGC 1 cut(s) 18
SspMI CTAG 1 cut(s) 47
TaaI ACNGT 2 cut(s) 42, 61
TaqI TCGA 2 cut(s) 56, 141
TasI AATT 1 cut(s) 11
Tru1I TTAA 1 cut(s) 187
Tru9I TTAA 1 cut(s) 187
TseFI GTSAC 1 cut(s) 42
Tsp45I GTSAC 1 cut(s) 42
TspDTI ATGAA 2 cut(s) 17, 165
TspGWI ACGGA 1 cut(s) 85
XapI RAATTY 1 cut(s) 11
XmiI GTMKAC 1 cut(s) 56
XspI CTAG 1 cut(s) 47
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.