Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003637.1

Orthogroup ID

OG0010944

Physical Location & Seq

Genomic Coordinates Reverse (-)

79 .. 3437

Gene Structure 3359 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003637.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 699 bp

atgaaactctccatatcttctcttcttcttcttatgaatcttatccagctatgtgggtgtgtacgtatgagtgtgttttcgactttcttcgtcgctctcttgcttctggtggctacagctgggataggaccaaatgtaatggttgctgaggctagaacttgtgacagtcagagcctcaagtacgagggaatgtgcttgagagggagccactgtgcatctgtttgccaaactgaggggtacagtggaggcgactgccacgggataggaccaaatgtaatggttgctgaggctagaacttgtgagagtcagagcctcaagtacgagggaatgtgcttgagagagagccactgtgcatctgtttgccaaactgaggggtacagtggaggcgactgccacgggataggaccaaatgtaatggttgctgaggctagaacttgtgagagtcagagcctcaagtacgagggaatgtgcttgagagagagccactgtgcatctgtttgccaaactgaggggtacagtggaggcgactgccacgatatgaatcagaagttcggtggagggaagctgccgaccggcactccatcgctggcttggtccagcgtcgtcgtcgtcgtctcacttctcgccggagcctccacattgcctcctgtcgatggtgttaatgtgaccaaggagaaggaatcggagaagaaagagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005618 GO:0005623 GO:0005886 GO:0006950 GO:0006952 GO:0008150 GO:0009505 GO:0016020 GO:0030312 GO:0044464 GO:0050896 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Gamma-thionin

Protein Analysis

232

Amino Acids

24.47

Weight (kDa)

5.53

Isoelectric Point (pI)

36.99

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010944)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G26055 AT5G57080
malus_domestica	MD16G1008700.v1.1
prunus_persica	Prupe.1G341800_v2.0.a1
pyrus_communis	pycom13g00930 pycom16g00840
rosa_chinensis	RchiOBHm_Chr4g0445811 RchiOBHm_Chr4g0445941
rosa_laevigata	RLG00000005709 RLG00000034739
rosa_multiflora	Rmu_sc0003637.1_g000001
rosa_roxburghii	Rroxscaffold_5G00386280 Rroxscaffold_5G00386300
rosa_rugosa	Rorug04G0365400
rosa_samantha	Rh4AG426800 Rh4AG427500 Rh4BG437200 Rh4CG454000 Rh4DG435100
rosa_wichuraiana	Rw4G036530

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfaI	GTAC	7 cut(s)	63, 182, 239, 320, 377, 458, 515
AfiI	CCNNNNNNNGG	4 cut(s)	232, 370, 508, 653
AluBI	AGCT	3 cut(s)	49, 119, 565
AluI	AGCT	3 cut(s)	49, 119, 565
Alw26I	GTCTC	1 cut(s)	619
ApeKI	GCWGC	1 cut(s)	565
AspS9I	GGNCC	4 cut(s)	128, 266, 404, 594
AvaII	GGWCC	4 cut(s)	128, 266, 404, 594
BbvCI	CCTCAGC	3 cut(s)	147, 285, 423
BbvI	GCAGC	1 cut(s)	552
BccI	CCATC	2 cut(s)	589, 647
BcoDI	GTCTC	1 cut(s)	619
BfaI	CTAG	3 cut(s)	153, 291, 429
BfmI	CTRYAG	1 cut(s)	114
BisI	GCNGC	1 cut(s)	566
BlsI	GCNGC	1 cut(s)	567
Bme18I	GGWCC	4 cut(s)	128, 266, 404, 594
BmgT120I	GGNCC	4 cut(s)	128, 266, 404, 594
BmiI	GGNNCC	2 cut(s)	206, 631
BmsI	GCATC	3 cut(s)	224, 362, 500
Bpu10I	CCTNAGC	3 cut(s)	147, 285, 423
BpuEI	CTTGAG	6 cut(s)	161, 217, 299, 355, 437, 493
BsaAI	YACGTR	1 cut(s)	65
BsaBI	GATNNNNATC	1 cut(s)	540
BsaJI	CCNNGG	3 cut(s)	256, 394, 669
BsaXI	ACNNNNNCTCC	6 cut(s)	196, 226, 562, 592, 628, 658
Bsc4I	CCNNNNNNNGG	4 cut(s)	232, 370, 508, 653
Bse118I	RCCGGY	1 cut(s)	572
Bse3DI	GCAATG	1 cut(s)	638
Bse8I	GATNNNNATC	1 cut(s)	540
BseDI	CCNNGG	3 cut(s)	256, 394, 669
BseJI	GATNNNNATC	1 cut(s)	540
BseLI	CCNNNNNNNGG	4 cut(s)	232, 370, 508, 653
BseMI	GCAATG	1 cut(s)	638
BseMII	CTCAG	6 cut(s)	138, 222, 276, 360, 414, 498
BseXI	GCAGC	1 cut(s)	552
BseYI	CCCAGC	1 cut(s)	119
Bsh1285I	CGRYCG	1 cut(s)	573
BsiEI	CGRYCG	1 cut(s)	573
BsiSI	CCGG	2 cut(s)	573, 627
BslI	CCNNNNNNNGG	4 cut(s)	232, 370, 508, 653
BsmAI	GTCTC	1 cut(s)	619
BsmBI	CGTCTC	1 cut(s)	619
BspCNI	CTCAG	6 cut(s)	139, 223, 277, 361, 415, 499
BspLI	GGNNCC	2 cut(s)	206, 631
BsrDI	GCAATG	1 cut(s)	638
BsrFI	RCCGGY	1 cut(s)	572
BssAI	RCCGGY	1 cut(s)	572
BssECI	CCNNGG	3 cut(s)	256, 394, 669
BssT1I	CCWWGG	1 cut(s)	669
Bst4CI	ACNGT	7 cut(s)	167, 212, 242, 350, 380, 488, 518
Bst6I	CTCTTC	1 cut(s)	27
BstBAI	YACGTR	1 cut(s)	65
BstC8I	GCNNGC	1 cut(s)	588
BstDEI	CTNAG	6 cut(s)	147, 231, 285, 369, 423, 507
BstDSI	CCRYGG	2 cut(s)	256, 394
BstMAI	GTCTC	1 cut(s)	619
BstMCI	CGRYCG	1 cut(s)	573
BstSFI	CTRYAG	1 cut(s)	114
BstSNI	TACGTA	1 cut(s)	65
BstV1I	GCAGC	1 cut(s)	552
BstXI	CCANNNNNNTGG	1 cut(s)	53
BtgI	CCRYGG	2 cut(s)	256, 394
BtgZI	GCGATG	1 cut(s)	567
BtsIMutI	CAGTG	6 cut(s)	208, 247, 346, 385, 484, 523
Cac8I	GCNNGC	1 cut(s)	588
Cfr10I	RCCGGY	1 cut(s)	572
Cfr13I	GGNCC	4 cut(s)	128, 266, 404, 594
CseI	GACGC	1 cut(s)	589
Csp6I	GTAC	7 cut(s)	62, 181, 238, 319, 376, 457, 514
CviQI	GTAC	7 cut(s)	62, 181, 238, 319, 376, 457, 514
DdeI	CTNAG	6 cut(s)	147, 231, 285, 369, 423, 507
Eam1104I	CTCTTC	1 cut(s)	27
EarI	CTCTTC	1 cut(s)	27
Eco105I	TACGTA	1 cut(s)	65
Eco130I	CCWWGG	1 cut(s)	669
Eco47I	GGWCC	4 cut(s)	128, 266, 404, 594
EcoT14I	CCWWGG	1 cut(s)	669
ErhI	CCWWGG	1 cut(s)	669
Esp3I	CGTCTC	1 cut(s)	619
FaiI	YATR	5 cut(s)	14, 35, 52, 68, 539
Fnu4HI	GCNGC	1 cut(s)	566
Fsp4HI	GCNGC	1 cut(s)	566
FspBI	CTAG	3 cut(s)	153, 291, 429
GluI	GCNGC	1 cut(s)	566
GsaI	CCCAGC	1 cut(s)	123
HapII	CCGG	2 cut(s)	573, 627
HgaI	GACGC	1 cut(s)	589
HinfI	GANTC	5 cut(s)	37, 304, 442, 541, 680
HpaII	CCGG	2 cut(s)	573, 627
Hpy166II	GTNNAC	1 cut(s)	62
Hpy188I	TCNGA	5 cut(s)	171, 309, 447, 546, 685
Hpy8I	GTNNAC	1 cut(s)	62
Hpy99I	CGWCG	5 cut(s)	95, 605, 608, 611, 614
HpyAV	CCTTC	1 cut(s)	670
HpyCH4III	ACNGT	7 cut(s)	167, 212, 242, 350, 380, 488, 518
HpyCH4IV	ACGT	1 cut(s)	64
HpyCH4V	TGCA	3 cut(s)	215, 353, 491
HpyF3I	CTNAG	6 cut(s)	147, 231, 285, 369, 423, 507
HpySE526I	ACGT	1 cut(s)	64
LmnI	GCTCC	2 cut(s)	204, 629
LpnPI	CCDG	8 cut(s)	59, 92, 105, 572, 586, 610, 640, 660
Lsp1109I	GCAGC	1 cut(s)	552
LweI	GCATC	3 cut(s)	224, 362, 500
MaeI	CTAG	3 cut(s)	153, 291, 429
MaeII	ACGT	1 cut(s)	64
MaeIII	GTNAC	2 cut(s)	161, 664
MboII	GAAGA	5 cut(s)	9, 14, 17, 20, 79
MlyI	GAGTC	2 cut(s)	313, 451
MseI	TTAA	1 cut(s)	660
MspA1I	CMGCKG	1 cut(s)	119
MspI	CCGG	2 cut(s)	573, 627
NlaIV	GGNNCC	2 cut(s)	206, 631
NmuCI	GTSAC	2 cut(s)	161, 664
PcsI	WCGNNNNNNNCGW	1 cut(s)	609
PfeI	GAWTC	3 cut(s)	37, 541, 680
PkrI	GCNGC	1 cut(s)	567
PleI	GAGTC	2 cut(s)	312, 450
PpsI	GAGTC	2 cut(s)	312, 450
Ppu21I	YACGTR	1 cut(s)	65
PspFI	CCCAGC	1 cut(s)	119
PspN4I	GGNNCC	2 cut(s)	206, 631
PspPI	GGNCC	4 cut(s)	128, 266, 404, 594
PvuII	CAGCTG	1 cut(s)	119
RsaI	GTAC	7 cut(s)	63, 182, 239, 320, 377, 458, 515
RsaNI	GTAC	7 cut(s)	62, 181, 238, 319, 376, 457, 514
SaqAI	TTAA	1 cut(s)	660
SatI	GCNGC	1 cut(s)	566
Sau96I	GGNCC	4 cut(s)	128, 266, 404, 594
SchI	GAGTC	2 cut(s)	313, 451
SetI	ASST	4 cut(s)	51, 67, 121, 567
SfaNI	GCATC	3 cut(s)	224, 362, 500
SfcI	CTRYAG	1 cut(s)	114
SinI	GGWCC	4 cut(s)	128, 266, 404, 594
SmlI	CTYRAG	6 cut(s)	176, 196, 314, 334, 452, 472
SmoI	CTYRAG	6 cut(s)	176, 196, 314, 334, 452, 472
SnaBI	TACGTA	1 cut(s)	65
SspMI	CTAG	3 cut(s)	153, 291, 429
StyI	CCWWGG	1 cut(s)	669
TaaI	ACNGT	7 cut(s)	167, 212, 242, 350, 380, 488, 518
TaiI	ACGT	1 cut(s)	67
TaqI	TCGA	2 cut(s)	80, 651
TfiI	GAWTC	3 cut(s)	37, 541, 680
Tru1I	TTAA	1 cut(s)	660
Tru9I	TTAA	1 cut(s)	660
TscAI	CASTG	6 cut(s)	215, 247, 353, 385, 491, 523
TseFI	GTSAC	2 cut(s)	161, 664
TseI	GCWGC	1 cut(s)	565
Tsp45I	GTSAC	2 cut(s)	161, 664
TspDTI	ATGAA	3 cut(s)	17, 50, 554
TspRI	CASTG	6 cut(s)	215, 247, 353, 385, 491, 523
VpaK11BI	GGWCC	4 cut(s)	128, 266, 404, 594
XcmI	CCANNNNNNNNNTGG	1 cut(s)	588
XspI	CTAG	3 cut(s)	153, 291, 429

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.