Rh4DG435100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Forward (+)
63846308 .. 63846496
189 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG435100.1

Sequence Viewer

Length: 189 bp
ATGGACCCGGATCCTCCATCGAAGCAAGGAACAAGGGTCGACCCGGAACTGCTTAACCTAACGACGTCGTTCACGTCACCTTCCCCAATAACACTTCGTCTTGCCAGAAACCAAAGAAAACAGTCCGACGAATCCAACTCTTTCCGGCGAAGCAAACTGTCTATTCGGACGCCGGTTGGTTCTCTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.93

Weight (kDa)

10.8

Isoelectric Point (pI)

69.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 68
AccI GTMKAC 1 cut(s) 39
AclWI GGATC 2 cut(s) 5, 18
AcyI GRCGYC 2 cut(s) 65, 170
AjiI CACGTC 1 cut(s) 75
AlwI GGATC 2 cut(s) 5, 18
AspS9I GGNCC 1 cut(s) 4
AsuC2I CCSGG 2 cut(s) 8, 44
AsuHPI GGTGA 1 cut(s) 69
AvaII GGWCC 1 cut(s) 4
BamHI GGATCC 1 cut(s) 10
BccI CCATC 1 cut(s) 25
BcnI CCSGG 2 cut(s) 8, 44
Bme1390I CCNGG 2 cut(s) 8, 44
Bme18I GGWCC 1 cut(s) 4
BmgBI CACGTC 1 cut(s) 75
BmgT120I GGNCC 1 cut(s) 4
BmiI GGNNCC 2 cut(s) 6, 12
BmrFI CCNGG 2 cut(s) 8, 44
BpuMI CCSGG 2 cut(s) 8, 44
BsaHI GRCGYC 2 cut(s) 65, 170
Bse118I RCCGGY 1 cut(s) 172
BsiSI CCGG 4 cut(s) 8, 44, 145, 173
Bsp143I GATC 1 cut(s) 10
BspLI GGNNCC 2 cut(s) 6, 12
BspPI GGATC 2 cut(s) 5, 18
BsrFI RCCGGY 1 cut(s) 172
BssAI RCCGGY 1 cut(s) 172
BssMI GATC 1 cut(s) 10
BssNI GRCGYC 2 cut(s) 65, 170
Bst4CI ACNGT 2 cut(s) 123, 159
BstACI GRCGYC 2 cut(s) 65, 170
BstKTI GATC 1 cut(s) 13
BstMBI GATC 1 cut(s) 10
BstSCI CCNGG 2 cut(s) 6, 42
BstX2I RGATCY 1 cut(s) 10
BstYI RGATCY 1 cut(s) 10
BtrI CACGTC 1 cut(s) 75
Cfr10I RCCGGY 1 cut(s) 172
Cfr13I GGNCC 1 cut(s) 4
CseI GACGC 1 cut(s) 178
DpnI GATC 1 cut(s) 12
DpnII GATC 1 cut(s) 10
Eco47I GGWCC 1 cut(s) 4
FblI GTMKAC 1 cut(s) 39
HapII CCGG 4 cut(s) 8, 44, 145, 173
HgaI GACGC 1 cut(s) 178
Hin1I GRCGYC 2 cut(s) 65, 170
HincII GTYRAC 1 cut(s) 40
HindII GTYRAC 1 cut(s) 40
HinfI GANTC 1 cut(s) 131
HpaII CCGG 4 cut(s) 8, 44, 145, 173
HphI GGTGA 1 cut(s) 69
Hpy166II GTNNAC 2 cut(s) 40, 72
Hpy188I TCNGA 2 cut(s) 127, 168
Hpy8I GTNNAC 2 cut(s) 40, 72
Hpy99I CGWCG 3 cut(s) 67, 70, 131
HpyAV CCTTC 1 cut(s) 90
HpyCH4III ACNGT 2 cut(s) 123, 159
HpyCH4IV ACGT 2 cut(s) 65, 74
HpySE526I ACGT 2 cut(s) 65, 74
Hsp92I GRCGYC 2 cut(s) 65, 170
Kzo9I GATC 1 cut(s) 10
LpnPI CCDG 4 cut(s) 21, 57, 118, 158
MaeII ACGT 2 cut(s) 65, 74
MaeIII GTNAC 1 cut(s) 75
MalI GATC 1 cut(s) 12
MboI GATC 1 cut(s) 10
MflI RGATCY 1 cut(s) 10
MmeI TCCRAC 2 cut(s) 150, 159
MnlI CCTC 1 cut(s) 24
MseI TTAA 1 cut(s) 54
MspI CCGG 4 cut(s) 8, 44, 145, 173
MspR9I CCNGG 2 cut(s) 8, 44
NciI CCSGG 2 cut(s) 8, 44
NdeII GATC 1 cut(s) 10
NlaIV GGNNCC 2 cut(s) 6, 12
NmuCI GTSAC 1 cut(s) 75
PcsI WCGNNNNNNNCGW 1 cut(s) 71
PfeI GAWTC 1 cut(s) 131
PspN4I GGNNCC 2 cut(s) 6, 12
PspPI GGNCC 1 cut(s) 4
PsuI RGATCY 1 cut(s) 10
SalI GTCGAC 1 cut(s) 38
SaqAI TTAA 1 cut(s) 54
Sau3AI GATC 1 cut(s) 10
Sau96I GGNCC 1 cut(s) 4
ScrFI CCNGG 2 cut(s) 8, 44
SetI ASST 4 cut(s) 60, 68, 77, 82
SinI GGWCC 1 cut(s) 4
StyD4I CCNGG 2 cut(s) 6, 42
TaaI ACNGT 2 cut(s) 123, 159
TaiI ACGT 2 cut(s) 68, 77
TaqI TCGA 2 cut(s) 20, 39
TfiI GAWTC 1 cut(s) 131
Tru1I TTAA 1 cut(s) 54
Tru9I TTAA 1 cut(s) 54
TseFI GTSAC 1 cut(s) 75
Tsp45I GTSAC 1 cut(s) 75
VpaK11BI GGWCC 1 cut(s) 4
XmiI GTMKAC 1 cut(s) 39
ZraI GACGTC 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.