Prupe.1G341800_v2.0.a1

Domain of unknown function (DUF4516)

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
32113936 .. 32114807
872 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G341800.1

Sequence Viewer

Length: 192 bp
ATGAATCAGAAATTCGGGGGAGGGAGGCGGCCCACCGGCACTCCTTCGTTGGCTTGGTCGTCCGTCGTTGTTGTCGTTTCGCTTCTCGCTGGGGCCTCCGTTGTCCACAATCTCTACAAGCCAGATCTCACGCTGCCTCCTGTGGATGGTGTAAACGGGAGCAAGGAGGGGAAGCAACCTGAGAAAGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

6.6

Weight (kDa)

9.3

Isoelectric Point (pI)

40.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 28
AcsI RAATTY 1 cut(s) 11
AfiI CCNNNNNNNGG 1 cut(s) 146
AoxI GGCC 2 cut(s) 29, 93
ApeKI GCWGC 1 cut(s) 133
ApoI RAATTY 1 cut(s) 11
AspS9I GGNCC 2 cut(s) 30, 93
BbvI GCAGC 1 cut(s) 120
BccI CCATC 1 cut(s) 140
BglII AGATCT 1 cut(s) 124
BisI GCNGC 2 cut(s) 29, 134
BlsI GCNGC 2 cut(s) 30, 135
BmgT120I GGNCC 2 cut(s) 30, 93
BmiI GGNNCC 1 cut(s) 94
BsaXI ACNNNNNCTCC 4 cut(s) 25, 55, 121, 151
Bsc4I CCNNNNNNNGG 1 cut(s) 146
Bse118I RCCGGY 1 cut(s) 35
BseGI GGATG 1 cut(s) 151
BseLI CCNNNNNNNGG 1 cut(s) 146
BseMII CTCAG 1 cut(s) 171
BseXI GCAGC 1 cut(s) 120
BseYI CCCAGC 1 cut(s) 89
BshFI GGCC 2 cut(s) 31, 95
BsiSI CCGG 1 cut(s) 36
BslI CCNNNNNNNGG 1 cut(s) 146
BsnI GGCC 2 cut(s) 31, 95
Bsp143I GATC 1 cut(s) 124
BspACI CCGC 1 cut(s) 28
BspANI GGCC 2 cut(s) 31, 95
BspCNI CTCAG 1 cut(s) 172
BspLI GGNNCC 1 cut(s) 94
BsrFI RCCGGY 1 cut(s) 35
BssAI RCCGGY 1 cut(s) 35
BssMI GATC 1 cut(s) 124
BstDEI CTNAG 1 cut(s) 180
BstF5I GGATG 1 cut(s) 151
BstKTI GATC 1 cut(s) 127
BstMBI GATC 1 cut(s) 124
BstV1I GCAGC 1 cut(s) 120
BstX2I RGATCY 1 cut(s) 124
BstYI RGATCY 1 cut(s) 124
BsuRI GGCC 2 cut(s) 31, 95
BtsCI GGATG 1 cut(s) 151
Cfr10I RCCGGY 1 cut(s) 35
Cfr13I GGNCC 2 cut(s) 30, 93
CviJI RGCY 4 cut(s) 31, 53, 95, 121
CviKI_1 RGCY 4 cut(s) 31, 53, 95, 121
DdeI CTNAG 1 cut(s) 180
DpnI GATC 1 cut(s) 126
DpnII GATC 1 cut(s) 124
EcoO109I RGGNCCY 1 cut(s) 93
Fnu4HI GCNGC 2 cut(s) 29, 134
FokI GGATG 1 cut(s) 158
Fsp4HI GCNGC 2 cut(s) 29, 134
GluI GCNGC 2 cut(s) 29, 134
GsaI CCCAGC 1 cut(s) 93
HaeIII GGCC 2 cut(s) 31, 95
HapII CCGG 1 cut(s) 36
HinfI GANTC 1 cut(s) 4
HpaII CCGG 1 cut(s) 36
Hpy166II GTNNAC 2 cut(s) 106, 154
Hpy188I TCNGA 1 cut(s) 9
Hpy8I GTNNAC 2 cut(s) 106, 154
Hpy99I CGWCG 1 cut(s) 68
HpyAV CCTTC 1 cut(s) 54
HpyF3I CTNAG 1 cut(s) 180
Kzo9I GATC 1 cut(s) 124
LmnI GCTCC 1 cut(s) 159
LpnPI CCDG 4 cut(s) 49, 75, 135, 153
Lsp1109I GCAGC 1 cut(s) 120
MalI GATC 1 cut(s) 126
MboI GATC 1 cut(s) 124
MflI RGATCY 1 cut(s) 124
MluCI AATT 1 cut(s) 11
MnlI CCTC 5 cut(s) 14, 18, 106, 147, 160
MspI CCGG 1 cut(s) 36
NdeII GATC 1 cut(s) 124
NlaIV GGNNCC 1 cut(s) 94
PcsI WCGNNNNNNNCGW 1 cut(s) 72
PfeI GAWTC 1 cut(s) 4
PkrI GCNGC 2 cut(s) 30, 135
PspFI CCCAGC 1 cut(s) 89
PspN4I GGNNCC 1 cut(s) 94
PspPI GGNCC 2 cut(s) 30, 93
PsuI RGATCY 1 cut(s) 124
SatI GCNGC 2 cut(s) 29, 134
Sau3AI GATC 1 cut(s) 124
Sau96I GGNCC 2 cut(s) 30, 93
SetI ASST 1 cut(s) 181
Sse9I AATT 1 cut(s) 11
SsiI CCGC 1 cut(s) 28
TasI AATT 1 cut(s) 11
TauI GCSGC 1 cut(s) 31
TfiI GAWTC 1 cut(s) 4
TseI GCWGC 1 cut(s) 133
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 2 cut(s) 52, 88
XapI RAATTY 1 cut(s) 11
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.