AT5G40645

RPM1-interacting protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
OG0005964
Physical Location & Seq
Reverse (-)
16280283 .. 16280993
711 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G40645.1

Sequence Viewer

Length: 222 bp
ATGGCATCGAATAATCAACAACGACAACAACAAGATCGACCATTACCAAAATTTGGAGAATGGGACGTGAACGATCCAGCATCAGCCGAAGGATTTACGGTTATATTCGCTAAAGCTCGAGACGACAAAAAGACAAACGCAAGTGGTCGTGCCGCCTCACAACGCCGTGACAATAACAAATCTCAAGATGAACCTACGAAGAAACGGTTCTGCTGTTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AvrRpt-cleavage

Protein Analysis

73

Amino Acids

8.33

Weight (kDa)

9.44

Isoelectric Point (pI)

50.39

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AvrRpt-cleavage PF05627 12 - 44 6e-18 Cleavage site for pathogenic type III effector avirulence factor Avr
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 53
AciI CCGC 1 cut(s) 153
AclWI GGATC 1 cut(s) 68
AcsI RAATTY 1 cut(s) 50
AfiI CCNNNNNNNGG 1 cut(s) 53
AjiI CACGTC 1 cut(s) 67
AluBI AGCT 1 cut(s) 116
AluI AGCT 1 cut(s) 116
Alw26I GTCTC 1 cut(s) 114
AlwI GGATC 1 cut(s) 68
Ama87I CYCGRG 1 cut(s) 117
ApoI RAATTY 1 cut(s) 50
Asp700I GAANNNNTTC 1 cut(s) 206
AvaI CYCGRG 1 cut(s) 117
BceAI ACGGC 1 cut(s) 150
BcoDI GTCTC 1 cut(s) 114
BisI GCNGC 1 cut(s) 153
BlsI GCNGC 1 cut(s) 154
BmeT110I CYCGRG 1 cut(s) 117
BmgBI CACGTC 1 cut(s) 67
BmsI GCATC 2 cut(s) 14, 89
BpuEI CTTGAG 1 cut(s) 168
Bsc4I CCNNNNNNNGG 1 cut(s) 53
BseLI CCNNNNNNNGG 1 cut(s) 53
BsiHKCI CYCGRG 1 cut(s) 117
BslFI GGGAC 1 cut(s) 77
BslI CCNNNNNNNGG 1 cut(s) 53
BsmAI GTCTC 1 cut(s) 114
BsmBI CGTCTC 1 cut(s) 114
BsmFI GGGAC 1 cut(s) 77
BsoBI CYCGRG 1 cut(s) 117
Bsp143I GATC 2 cut(s) 34, 73
BspACI CCGC 1 cut(s) 153
BspPI GGATC 1 cut(s) 68
BssMI GATC 2 cut(s) 34, 73
Bst4CI ACNGT 2 cut(s) 100, 207
BstKTI GATC 2 cut(s) 37, 76
BstMAI GTCTC 1 cut(s) 114
BstMBI GATC 2 cut(s) 34, 73
BtrI CACGTC 1 cut(s) 67
CviJI RGCY 2 cut(s) 86, 116
CviKI_1 RGCY 2 cut(s) 86, 116
DpnI GATC 2 cut(s) 36, 75
DpnII GATC 2 cut(s) 34, 73
Eco88I CYCGRG 1 cut(s) 117
Esp3I CGTCTC 1 cut(s) 114
FaiI YATR 1 cut(s) 104
FaqI GGGAC 1 cut(s) 77
Fnu4HI GCNGC 1 cut(s) 153
Fsp4HI GCNGC 1 cut(s) 153
GluI GCNGC 1 cut(s) 153
Hpy166II GTNNAC 1 cut(s) 70
Hpy188I TCNGA 1 cut(s) 221
Hpy188III TCNNGA 2 cut(s) 119, 185
Hpy8I GTNNAC 1 cut(s) 70
HpyAV CCTTC 1 cut(s) 83
HpyCH4III ACNGT 2 cut(s) 100, 207
HpyCH4IV ACGT 1 cut(s) 66
HpySE526I ACGT 1 cut(s) 66
Kzo9I GATC 2 cut(s) 34, 73
LpnPI CCDG 1 cut(s) 90
LweI GCATC 2 cut(s) 14, 89
MaeII ACGT 1 cut(s) 66
MaeIII GTNAC 1 cut(s) 167
MalI GATC 2 cut(s) 36, 75
MboI GATC 2 cut(s) 34, 73
MboII GAAGA 1 cut(s) 211
MluCI AATT 1 cut(s) 50
MnlI CCTC 1 cut(s) 166
MroXI GAANNNNTTC 1 cut(s) 206
NdeII GATC 2 cut(s) 34, 73
NmuCI GTSAC 1 cut(s) 167
PaeR7I CTCGAG 1 cut(s) 117
PdmI GAANNNNTTC 1 cut(s) 206
PflMI CCANNNNNTGG 1 cut(s) 53
PkrI GCNGC 1 cut(s) 154
SatI GCNGC 1 cut(s) 153
Sau3AI GATC 2 cut(s) 34, 73
SetI ASST 3 cut(s) 69, 118, 196
SfaNI GCATC 2 cut(s) 14, 89
Sfr274I CTCGAG 1 cut(s) 117
SgeI CNNG 9 cut(s) 44, 79, 89, 129, 131, 153, 161, 179, 197
SlaI CTCGAG 1 cut(s) 117
SmlI CTYRAG 2 cut(s) 117, 183
SmoI CTYRAG 2 cut(s) 117, 183
Sse9I AATT 1 cut(s) 50
SsiI CCGC 1 cut(s) 153
TaaI ACNGT 2 cut(s) 100, 207
TaiI ACGT 1 cut(s) 69
TaqI TCGA 3 cut(s) 8, 37, 118
TasI AATT 1 cut(s) 50
TauI GCSGC 1 cut(s) 155
TseFI GTSAC 1 cut(s) 167
Tsp45I GTSAC 1 cut(s) 167
TspDTI ATGAA 1 cut(s) 204
Van91I CCANNNNNTGG 1 cut(s) 53
XapI RAATTY 1 cut(s) 50
XhoI CTCGAG 1 cut(s) 117
XmnI GAANNNNTTC 1 cut(s) 206
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.